Educalingo cookies are used to personalize ads and get web traffic statistics. We also share information about the use of the site with our social media, advertising and analytics partners.
View details Got it
Download the app

Meaning of "f.w.d." in the English dictionary



f.w.d. play


Definition of f.w.d. in the English dictionary

The definition of f.w.d. in the dictionary is four-wheel drive. Other definition of f.w.d. is front-wheel drive.


FA Cup
Fa Ngum
Fa Xian



Synonyms and antonyms of f.w.d. in the English dictionary of synonyms


Translation of «f.w.d.» into 25 languages

online translator


Find out the translation of f.w.d. to 25 languages with our English multilingual translator.
The translations of f.w.d. from English to other languages presented in this section have been obtained through automatic statistical translation; where the essential translation unit is the word «f.w.d.» in English.

Translator English - Chinese

1,325 millions of speakers

Translator English - Spanish

570 millions of speakers


510 millions of speakers

Translator English - Hindi

380 millions of speakers

Translator English - Arabic

280 millions of speakers

Translator English - Russian

278 millions of speakers

Translator English - Portuguese

270 millions of speakers

Translator English - Bengali

260 millions of speakers

Translator English - French

220 millions of speakers

Translator English - Malay

190 millions of speakers

Translator English - German

180 millions of speakers

Translator English - Japanese

130 millions of speakers

Translator English - Korean

85 millions of speakers

Translator English - Javanese

85 millions of speakers

Translator English - Vietnamese

80 millions of speakers

Translator English - Tamil

75 millions of speakers

Translator English - Marathi

75 millions of speakers

Translator English - Turkish

70 millions of speakers

Translator English - Italian

65 millions of speakers

Translator English - Polish

50 millions of speakers

Translator English - Ukrainian

40 millions of speakers

Translator English - Romanian

30 millions of speakers

Translator English - Greek

15 millions of speakers

Translator English - Afrikaans

14 millions of speakers

Translator English - Swedish

10 millions of speakers

Translator English - Norwegian

5 millions of speakers

Trends of use of f.w.d.



The term «f.w.d.» is very widely used and occupies the 17.026 position in our list of most widely used terms in the English dictionary.
Very widely used
The map shown above gives the frequency of use of the term «f.w.d.» in the different countries.
Principal search tendencies and common uses of f.w.d.
List of principal searches undertaken by users to access our English online dictionary and most widely used expressions with the word «f.w.d.».


The graph expresses the annual evolution of the frequency of use of the word «f.w.d.» during the past 500 years. Its implementation is based on analysing how often the term «f.w.d.» appears in digitalised printed sources in English between the year 1500 and the present day.

Examples of use in the English literature, quotes and news about f.w.d.



Discover the use of f.w.d. in the following bibliographical selection. Books relating to f.w.d. and brief extracts from same to provide context of its use in English literature.
Fluorescence Microscopy
The first volume deals with instrumentation and techniques for fluorescence microscopy, and includes a chapter on quantification and scanning. The second volume deals with the applications of fluorescence microscopy in many fields.
F. W. D. Rost, 1995
Quantitative Fluorescence Microscopy
This book is a complete guide to this technique for all biologists. It describes the principles and applications of quantitative fluorescence microscopy and also gives much practical information about the instrumentation required.
F. W. D. Rost, 1991
American Military Vehicles of World War I: An Illustrated ...
Meanwhile, since the American military brass were still experimenting, FWD had to find its own civilian markets to continue its tentative existence. No assembly line meant that FWD cars and trucks were hand-built one by one, resulting in a ...
Albert Mroz, 2009
EMAILS Fwd:FW:: The Difference
The Difference Gerry Gialogo Grindulo. 0'. I 'I . - 1 ' ' . ' I P l A 0 I I I 1 J ,_ 1' ' 9 . n I O O O i '. ' .0 ' . O o O .0 I o O ' .oze..... '7'} .5. TDifference COMMUNICATION GENERATION EMAILS Fwd: FW: THE DIFFERENCE COMMUNICATION ...
Gerry Gialogo Grindulo, 2010
Nondestructive Testing of Pavements and Backcalculation of ...
A device for this purpose is sold by the FWD manufacturer. With periodic calibration of the geophones, using an external, independent reference instrumentation system, the systematic error of each deflection sensor can generally be much ...
Albert Jasper Bush, Gilbert Y. Baladi, 1989
IBM Flex System and PureFlex System Network Implementation ...
+ FWD DESG 807e-08:17:f4:33:75:00 8440 P2P 2 (pc65) 128 115!+ FWD DESG 807e-08:17:f4:33:75:00 8440 P2P 3 (pc65) 128 115!+ FWD DESG 807e-08:17:f4: 33:75:00 8440 P2P 4 (pc65) 128 115!+ FWD DESG 807e-08:17:f4:33:75:00 ...
Jon Tate, Jure Arzensek, David Cain, 2013
Resilient Modulus Testing for Pavement Components
Falling Weight Deflectometer Tests Falling weight deflectometer (FWD) tests were performed at STH 60 to determine the operative elastic moduli of the Grade 2 subbase, bottom ash, and foundry slag. The FWD tests were conducted ...
Gary N. Durham, W. Allen Marr, William L. DeGroff, 2003
Molecular Genetics of Dorsal Spine Reduction in Threespine ...
Table 3-9: Microsatellite Markers Primer Name Sequence Stn42 fwd ACACGCAGCTTGACTGTTCC Stn42 rev GCGTATACGTTACACGCCG Stn45 fwd ACGAGGGTTTGAGTCTCTCC Stn45 rev GTTGTTCAATCCATCCGTCC Stn365 fwd ...
Brian Russell Summers, 2008
Nondestructive Testing of Pavements and Backcalculation of ...
Consistent placement of the FWD measurement system should be followed, and the placement geometry should be documented. 2. Normalize the measured deflections to a standard FWD load level (e.g., 9000 Ib [40 kN|), and calculate the  ...
Harold L. Von Quintus, Albert Jasper Bush, Gilbert Y. Baladi, 1994
Popular Science
Maker or Seller Name & Model Hp Transmission type Speed range Impl. lift Wt. ( Ib.) Comments Max. cut ALLIS- CHALMERS 720 19.5 Hydro plus 3-spd. ltd. slip differ. Hydro; ltd. slip. Hydro; ltd. slip. Shuttle Gear Gear Gear 3 ranges, fwd. & rev.

« EDUCALINGO. F.w.d. [online]. Available <>. Dec 2022 ».
Download the educalingo app
English dictionary
Discover all that is hidden in the words on
a b c d e f g h i j k l m n o p q r s t u v w x y z