Educalingo cookies are used to personalize ads and get web traffic statistics. We also share information about the use of the site with our social media, advertising and analytics partners.
View details Got it
Download the app
educalingo
Search

Meaning of "GBA" in the English dictionary

Dictionary
DICTIONARY
section

ETYMOLOGY OF THE WORD GBA

From G(reat) B(ritain) A(lderney).
info
Etymology is the study of the origin of words and their changes in structure and significance.
facebooktwitterpinterestwhatsapp
section

PRONUNCIATION OF GBA

GBA play
facebooktwitterpinterestwhatsapp

WHAT DOES GBA MEAN IN ENGLISH?

GBA

Game Boy Advance

The Game Boy Advance, often shortened to GBA, is a 32-bit handheld video game console developed, manufactured and marketed by Nintendo. It is the successor to the Game Boy Color. It was released in Japan on March 21, 2001; in North America on June 11, 2001; in Australia and Europe on June 22, 2001; and in the People's Republic of China on June 8, 2004. Nintendo's competitors in the handheld market were the Neo Geo Pocket Color, SwanCrystal, GP32, Tapwave Zodiac, and the N-Gage. Despite the competitors' best efforts, Nintendo maintained its majority market share with the Game Boy Advance. As of June 30, 2009, the Game Boy Advance series has sold 81.48 million units worldwide. Its successor, the Nintendo DS, was released in November 2004.

Definition of GBA in the English dictionary

The definition of GBA in the dictionary is Alderney.

WORDS THAT BEGIN LIKE GBA

Gb
GBE
GBG
GBH
GBJ
GBL
GBM
GBS
GBZ
GC
GCA
GCB
GCE

WORDS THAT END LIKE GBA

ARIBA
FBA
GABA
IBA
MBA
NBA
PABA
SBA
UKBA
WBA
YBA

Synonyms and antonyms of GBA in the English dictionary of synonyms

SYNONYMS

Translation of «GBA» into 25 languages

TRANSLATOR
online translator

TRANSLATION OF GBA

Find out the translation of GBA to 25 languages with our English multilingual translator.
The translations of GBA from English to other languages presented in this section have been obtained through automatic statistical translation; where the essential translation unit is the word «GBA» in English.

Translator English - Chinese

GBA
1,325 millions of speakers

Translator English - Spanish

GBA
570 millions of speakers

English

GBA
510 millions of speakers

Translator English - Hindi

GBA
380 millions of speakers
ar

Translator English - Arabic

غبا
280 millions of speakers

Translator English - Russian

GBA
278 millions of speakers

Translator English - Portuguese

GBA
270 millions of speakers

Translator English - Bengali

Gba
260 millions of speakers

Translator English - French

ACS
220 millions of speakers

Translator English - Malay

GBA
190 millions of speakers

Translator English - German

GBA
180 millions of speakers

Translator English - Japanese

GBA
130 millions of speakers

Translator English - Korean

GBA
85 millions of speakers

Translator English - Javanese

GBA
85 millions of speakers
vi

Translator English - Vietnamese

GBA
80 millions of speakers

Translator English - Tamil

கடைசியில்
75 millions of speakers

Translator English - Marathi

GBA
75 millions of speakers

Translator English - Turkish

GBA
70 millions of speakers

Translator English - Italian

GBA
65 millions of speakers

Translator English - Polish

GBA
50 millions of speakers

Translator English - Ukrainian

GBA
40 millions of speakers

Translator English - Romanian

GBA
30 millions of speakers
el

Translator English - Greek

GBA
15 millions of speakers
af

Translator English - Afrikaans

GBA
14 millions of speakers
sv

Translator English - Swedish

GBA
10 millions of speakers
no

Translator English - Norwegian

GBA
5 millions of speakers

Trends of use of GBA

TRENDS

TENDENCIES OF USE OF THE TERM «GBA»

The term «GBA» is very widely used and occupies the 13.676 position in our list of most widely used terms in the English dictionary.
0
100%
FREQUENCY
Very widely used
94
/100
The map shown above gives the frequency of use of the term «GBA» in the different countries.
Principal search tendencies and common uses of GBA
List of principal searches undertaken by users to access our English online dictionary and most widely used expressions with the word «GBA».

FREQUENCY OF USE OF THE TERM «GBA» OVER TIME

The graph expresses the annual evolution of the frequency of use of the word «GBA» during the past 500 years. Its implementation is based on analysing how often the term «GBA» appears in digitalised printed sources in English between the year 1500 and the present day.

Examples of use in the English literature, quotes and news about GBA

EXAMPLES

10 ENGLISH BOOKS RELATING TO «GBA»

Discover the use of GBA in the following bibliographical selection. Books relating to GBA and brief extracts from same to provide context of its use in English literature.
1
Game Console Hacking: Xbox, PlayStation, Nintendo, Game Boy, ...
Figure 5.23 New Display Lens Light Up Your LCD with the GBA Afterburner Mod One disadvantage to the Game Boy Advance is the lack of any built-in lighting solution for the LCD. (The Game Boy Advance SP is the first in the Game Boy ...
Joe Grand, Albert Yarusso, 2004
2
Handbook of Research on Wireless Security
HTTP-based service request using GBA_U (GBA-aware USIM) GB A B oo tstrap ping GB A B oo tstrap ping NAF specific Keys: NAF specific Keys: Ks_int_NAF, Ks_ext_NAF Ks_int_NAF, Ks_ext_NAF a service a service 0 Unauthorized / GPP  ...
Yan Zhang, Jun Zheng, Miao Ma, 2008
3
Gaucher Disease
Despite the length differences, psGBA has maintained 967r sequence identity with the functional GBA gene. One important distinction between the two sequences is a 55-bp deletion in exon 9 of the pseudogene. The existence of a highly ...
Anthony H. Futerman, Ari Zimran, 2006
4
The Open Mobile Alliance: Delivering Service Enablers for ...
13.2.5.2 SEC-CF Technical Specification: OMA GBA Profile The GBA [3GPP TS 33.220][3GPP2 S.S0109] provides a secure and reliable method to bootstrap a security association between a client and a server, using long-term security ...
Michael Brenner, Musa Unmehopa, 2008
5
Introduction
16h, v. to take away : 6 gba. mi II a^o 16h, he took away my cloth. gba...lo-WO (li), v. with one objective, to help, succor ; with two, to deprive of, to take away from : 6 gba. mi lowo, he assisted me ; 6 gba, omo lowo mi, he deprived me of my ...
‎1858
6
Grammar and dictionary of the Yoruba language. (Smithsonian ...
Iu, v. to dash or cast upon the shore, as waves : 6 gba <}ko lu okuta, it cast the ship upon the rocks. gbam-gbam, adv. tightly, compactly (tied up). gbfi. . . . m6-ra ( ara), v. to embrace, hug. gbft . . . mu, v. to seize upon, to make a pretext of.
Thomas J. Bowen, 1858
7
The African Palimpsest: Indigenization of Language in the ...
Olee arm gba aji Gba aji Olee anu gba aji Gba aji Mmadu gba aji Gba aji Nkita gba aji Gba aji Oke gba aji Gba aji Okuko gba aji Olee anu gba aji Gba aji Olee anu gba aji Gba aji Ewu gba aji Gba aji Ehi gba aji Gba aji Ngwere gba aji Olee ...
Chantal J. Zabus, 2007
8
Retro Gaming Hacks
So, let's say you've set up a Game Boy Advance emulator IHack #441 and begun to delve into enjoying the fruits of the vibrant GBA homebrew scene. But playing these games on your PC monitor just isn't enough — isn't there some way to get ...
Chris Kohler, 2006
9
JIMD Reports - Case and Research Reports, 2012/3
Table 2 Primers used for amplification and sequencing of the GBA gene Primer Sequence Amplicon size Template GBA-XL1F CTGGGATTTAGGAGCCTCTACC 3493 Genomic DNA GBA-XL1R AAGATTGACAGGCCCAAGGC GBA-XL2F ...
Verena Peters, 2012
10
Women's Health in Canada: Critical Perspectives on Theory ...
evaluations of GBA in the health sector have been undertaken (Hankivsky, 2005). Another contributing impediment to effective GBA is the multi-jurisdictional nature of Canada. Even though GBA has been established as a key federal policy ...
Marina Morrow, Olena Hankivsky, Colleen Varcoe, 2008

10 NEWS ITEMS WHICH INCLUDE THE TERM «GBA»

Find out what the national and international press are talking about and how the term GBA is used in the context of the following news items.
1
GBA opts for tried and trusted Mercedes-Benz Sprinters
Proven reliability in a high-pressure application persuaded leading time-critical delivery specialist GBA Services to invest once again in the ... «Materials Handling World Magazine, Jul 15»
2
Nintendo Shuts Down Browser Based Game Boy Emulator …
“Nintendo requests that GitHub, Inc., disable public access to the web site at http://jsemu.github.io/gba/,” Nintendo writes in their takedown ... «TorrentFreak, Jul 15»
3
Energy Spotlight: Aurora Sharrard | TribLIVE
Through educational programs, grants and networking events, GBA looks to “entice and inform and inspire people to create healthy and ... «Tribune-Review, Jul 15»
4
Making savings from European drugs budgets - PMLiVE
He says there is often not an agreement between IQWiG, the GBA and pharma on what the reimbursement should be. “Eleven times last year ... «PMLiVE, Jul 15»
5
Opinion/Column: Make debt free college a reality - The Daily Progress
A January poll by GBA Strategies on behalf of the Progressive Change Institute shows 71 percent or respondents in favor of just such a plan, ... «The Daily Progress, Jul 15»
6
Pinnacle Bank's Jackson McConnell named Georgia Bankers …
As chairman of GBA, McConnell will guide the association's government relations and public advocacy efforts, educational programming for ... «Covington News, Jul 15»
7
The five best JRPGs for beginners - TechnoBuffalo
... choices entirely. Stick to the original or GBA version, maybe the PlayStation one, for the most authentic and user friendly experience. «TechnoBuffalo, Jul 15»
8
Suspects in attack on judge, husband for ID parade
The Guyana Bar Association (GBA) yesterday registered its shock at the “brutal attack” and its “increasing concern” at escalating incidents of ... «Stabroek News, Jul 15»
9
Behold: One Tantalizing Minute of Resident Evil 0's Scrapped N64 …
Though this project definitely had other issues, it eventually resurfaced on the GBA as essentially the same game in a different format--seriously ... «USgamer, Jul 15»
10
Bar Association shocked by attack on judge and family
The Guyana Bar Association (GBA) today expressed shock at yesterday's attack on land court judge, Nicola Pierre and her family. A GBA ... «Stabroek News, Jul 15»

REFERENCE
« EDUCALINGO. Gba [online]. Available <https://educalingo.com/en/dic-en/gba>. Dec 2022 ».
Download the educalingo app
en
English dictionary
Discover all that is hidden in the words on
index
a b c d e f g h i j k l m n o p q r s t u v w x y z