Significato di "pelf" sul dizionario di inglese

ETIMOLOGIA DELLA PAROLA PELF

From Old French pelfre booty; related to Latin pilāre to despoil.

Etimologia è lo studio dell'origine della parola e dei cambiamenti strutturali e di significato che esse subiscono.

PRONUNCIA DI PELF IN INGLESE

pelf  [pɛlf]

CATEGORIA GRAMMATICALE DI PELF

Pelf è un sostantivo.

Il nome o sostantivo è il tipo di parole il cui significato determina la realtà. I sostantivi nominano tutte le cose: persone, oggetti, sensazioni, sentimenti, ecc.

CHE SIGNIFICA PELF IN INGLESE

I soldi

Money

Il denaro è qualsiasi oggetto o documento verificabile che è generalmente accettato come pagamento per beni e servizi e il rimborso di debiti in un determinato paese o contesto socioeconomico. Le principali funzioni di denaro si distinguono come: mezzo di scambio; Una unità di conto; Un magazzino di valore; E, talvolta, in passato, uno standard di pagamento differito. Ogni tipo di oggetto o record verificabile che soddisfa queste funzioni può essere considerato denaro. Il denaro è storicamente un fenomeno di mercato emergente che istituisce un denaro di merci, ma quasi tutti i sistemi monetari contemporanei si basano su denaro fiat. Il denaro di Fiat, come qualsiasi controllo o nota di debito, è senza valore intrinseco di utilizzo come merce fisica. Esso deriva il suo valore dichiarandosi legale da parte di un governo; Cioè deve essere accettato come una forma di pagamento all'interno dei confini del paese, per "tutti i debiti, pubblici e privati". Tali leggi in pratica causano denaro fiat per acquisire il valore di una qualsiasi delle merci e dei servizi per cui può essere scambiata all'interno della nazione che lo emette. L'offerta di denaro di un paese è costituita da valuta e di solito include denaro bancario.

Money is any object or verifiable record that is generally accepted as payment for goods and services and repayment of debts in a particular country or socio-economic context. The main functions of money are distinguished as: a medium of exchange; a unit of account; a store of value; and, occasionally in the past, a standard of deferred payment. Any kind of object or verifiable record that fulfills these functions can be considered money. Money is historically an emergent market phenomenon establishing a commodity money, but nearly all contemporary money systems are based on fiat money. Fiat money, like any check or note of debt, is without intrinsic use value as a physical commodity. It derives its value by being declared by a government to be legal tender; that is, it must be accepted as a form of payment within the boundaries of the country, for "all debts, public and private". Such laws in practice cause fiat money to acquire the value of any of the goods and services that it may be traded for within the nation that issues it. The money supply of a country consists of currency and usually includes bank money.

definizione di pelf nel dizionario inglese

La definizione di pelf nel dizionario è denaro o ricchezza, specialmente se disonestamente acquisita; lucro.

TRADUZIONE DI PELF

Conosci la traduzione di pelf in 25 lingue con il nostro traduttore inglese multilingue.

Le traduzioni di pelf verso altre lingue presenti in questa sezione sono il risultato di una traduzione automatica statistica; dove l'unità essenziale della traduzione è la parola «pelf» in inglese.

• Traduttore italiano - cinese: PELF
• Traduttore italiano - spagnolo: pelf
• inglese: pelf
• Traduttore italiano - hindi: स्र्पये
• Traduttore italiano - arabo: pelf
• Traduttore italiano - russo: PELF
• Traduttore italiano - portoghese: pelf
• Traduttore italiano - bengalese: টাকাকড়ি
• Traduttore italiano - francese: lucre
• Traduttore italiano - malese: Pelf
• Traduttore italiano - tedesco: Moneten
• Traduttore italiano - giapponese: あぶく銭
• Traduttore italiano - coreano: pelf
• Traduttore italiano - giavanese: Pelem
• Traduttore italiano - vietnamita: tiền bạc
• Traduttore italiano - tamil: pelf
• Traduttore italiano - marathi: पीएलएच
• Traduttore italiano - turco: vurgun
• Traduttore italiano - italiano: pelf
• Traduttore italiano - polacco: Pelf
• Traduttore italiano - ucraino: PELF
• Traduttore italiano - rumeno: parale
• Traduttore italiano - greco: παράδες
• Traduttore italiano - afrikaans: duiten
• Traduttore italiano - svedese: pelf
• Traduttore italiano - norvegese: pelf

10 LIBRI IN INGLESE ASSOCIATI CON «PELF»

Scopri l'uso di pelf nella seguente selezione bibliografica. Libri associati con pelf e piccoli estratti per contestualizzare il loro uso nella letteratura.

Pelf - Emily's Men of Greed:

If you're reading this book and did not purchase it, or it was not purchased for your use only, then please return to Google Play and purchase your own copy. Thank you for respecting the hard work of this author. Contents Pelf About the Author ...

Derek Haines, 2014

The Collected Stories of J.A. Cummings

‚Oh, yes,‛ Pelf said. ‚I do believe in you.‛ ‚And do you believe in yourself, Pelf? If you do not, then you can never learn the secrets that I have to tell.‛ Pelf swallowed hard and searched his feelings. ‚Yes,‛ he nodded, knowing it was true.

J.A. Cummings

Walls

Jinks was impressed, and after the intense psychological screening that every potential SWAT officer receives, Pelf was placed in training. Three months later, thirty days of climbing barricades, hurdling through the obstacle course, being ...

D. C. Wilson, Nancy Rabuck Wilson, 2001

Field Guide to Freshwater Fishes of California

DESCRIPTION: Long AF ( 16 to 19 rays); prickles on skin behind PecF or over entire body; DF usually joined to one-third height of first soft ray; 1st DF = 8 to 10, 2d DF = 19 to23,PelF = 4, AF = 17 to 19; ad. SL 6 to 9 cm (2.4 to 3.5 in.), max.

Samuel M. McGinnis, 2006

Antimicrobial Therapy in Veterinary Medicine

Steeve Giguère, John F. Prescott, Patricia M. Dowling. (A) 10 + Plasma —I— PELF 1 + BAL cells DCA concentration (pg/mL) O :0 O 0.001 . I I I I I I I I I I 0 24 48 72 96 120 144 168 192 216 240 Time (h) ...

Steeve Giguère, John F. Prescott, Patricia M. Dowling, 2013

Class Politics in the Information Age

Professional Pelf While the surplus wage threshold is basic to determining the respective shares of labor and professionals in surplus wages, the average paycheck defines the lower limit of professionals' pelf comparable to capital income or ...

Donald Clark Hodges, 2000

Multidimensional NMR Methods for the Solution State

(Top) Simulation of the outcome of a DISTINCT scheme (a) with respect to a classical powder pattern (b) for a heteronuclear dipolar coupling. (Bottom) Example of the DISTINCT PELF spectrum on the headgroup and glycerol regions of lecithin ...

Gareth A. Morris, James W. Emsley, 2012

Men and Manners: A Novel

ed with the requisites tor the meal, Mrs. Pelf ordered her to call in her master. Presently Pelf returned.- " That young sellow," he said, "that- came in for debt this morning, is half distracted yonder for want of company, and praying like bewitched ...

Francis Lathom, 1800

Legionella: from protozoa to humans

Primer name Nucleotide sequence pelA cya F pelA cya R CTGCAGCTACATGAGCACACAAACAG pelB cya F pelB cya R pelD cya F pelD cya R pelE cya F pelE cya R pelF cya F GGATCCTTATGCGTAGCAGAACAGAA pelF cya R pelH cya F ...

Carmen Buchrieser

The English dialect dictionary, being the complete ...

The April hoeing, when many thistles would be, as a matter of course, cut up with the other 'pelf' (H.K.). Glo.l Car. And I raked all the pilf off the land, THOMAS Rairdiga! Rhymes (1895) 6; Cor.1 Light grass and roots raked together to be burnt; ...

Joseph Wright

10 NOTIZIE DOVE SI INCLUDE IL TERMINE «PELF»

Vedi di che si parla nei media nazionali e internazionali e come viene utilizzato il termine ino pelf nel contesto delle seguenti notizie.

How Serious Are The Twins About 2015?

Pelf could have some value to a sub-.500 club that simply needs a guy to eat innings while treading water, but for a team like the Twins that is in ... «Twins Daily, lug 15»

Doling Out Thoughts

Just a cursory look at the pelf and privileges enjoyed by unelected, and far less accountable, senior government employees, makes that clear. «Outlook, lug 15»

Letter: GOP's future

Fat cat donors directly or indirectly derive their pelf from the availability of cheap labor from people who can survive while working for less than ... «New Bern Sun Journal, lug 15»

Time for BCCI to put its house in order

... has become a motley body of vested interests willing to fight or sleep with each other for power and pelf, not necessarily to the game's benefit ... «Hindustan Times, lug 15»

Surjya, Biman slam Mamata on corruption

... of wealth and pelf of the Trinamool leaders on each passing day, the Opposition leader and CPI(M) state secretary Surjya Kanta Mishra came ... «The Echo of India, lug 15»

A Ramadan story

... that their sacrifice and compassion for “their brother” will serve as a template for those who, in their insatiable greed for power, pomp and pelf, ... «Trinidad News, lug 15»

Learning to live with political dynasties

Dynasty: We just have to learn to live with it even if our dynasty-creating, power-kapit-tuko politicians insist on passing on positions and pelf to ... «Inquirer.net, lug 15»

Man who could do no wrong: N Srinivasan's charmed reign over …

There was unprecedented power and pelf at Srinivasan's disposal. Before his tenure, a BCCI president had one term of three years. In 2012, a ... «Economic Times, lug 15»

Love Is Blind, and So Are the Courtney Love Haters

Sorry, Courtney Love is not a blond ingenue who conned her way to fame and pelf. No, she hustled (literally, at a Times Square peep show in ... «Newsweek, lug 15»

Modi's honeymoon is over

The BJP, despite its RSS stream, is as steeped in the culture of manipulative politics as any other party and as tempted by the power and pelf of ... «Chandigarh Tribune, lug 15»