Significado de "stulic" en el diccionario de polaco

PRONUNCIACIÓN DE STULIC EN POLACO

stulic

TRADUCCIÓN DE STULIC

Conoce la traducción de stulic a 25 idiomas con nuestro traductor multilingüe.

Las traducciones de stulic presentadas en esta sección han sido obtenidas mediante traducción automática estadística a partir del idioma polaco.

• Traductor polaco - chino: stulić
• Traductor polaco - español: Štulić
• Traductor polaco - inglés: stulić
• Traductor polaco - hindi: stulić
• Traductor polaco - árabe: stulić
• Traductor polaco - ruso: stulić
• Traductor polaco - portugués: stulić
• Traductor polaco - bengalí: stulić
• Traductor polaco - francés: stulić
• Traductor polaco - malayo: Stulic
• Traductor polaco - alemán: Stulić
• Traductor polaco - japonés: stulić
• Traductor polaco - coreano: stulić
• Traductor polaco - javanés: stulić
• Traductor polaco - vietnamita: stulić
• Traductor polaco - tamil: stulić
• Traductor polaco - maratí: stulić
• Traductor polaco - turco: stulić
• Traductor polaco - italiano: Stulic
• polaco: stulic
• Traductor polaco - ucraniano: stulić
• Traductor polaco - rumano: stulić
• Traductor polaco - griego: stulić
• Traductor polaco - afrikáans: stulić
• Traductor polaco - sueco: stulić
• Traductor polaco - noruego: stulić

10 LIBROS DEL POLACO RELACIONADOS CON «STULIC»

Descubre el uso de stulic en la siguiente selección bibliográfica. Libros relacionados con stulic y pequeños extractos de los mismos para contextualizar su uso en la literatura.

Shake, Rattle and Roll: Yugoslav Rock Music and the Poetics of ...

Štulić's peripherality to the narrative, thus, is by no means suggestive of him being marginal to the world, that is, being detached from and lost in it. On the contrary, it is his poetical marginality that is the source of his full awareness of the world, ...

Dalibor Mišina, 2016

Słownik języka polskiego - Tom 3 - Strona 335

Kort stula uszy. Pies stulil ogon. Motyl stulil skrzydta. Stulone ptatki rózy. O fraz. Stulic uszy «staé sic potulnym, pokomym; prze- straszyé sie» O posp. Stulié gebç, pysk (zwykle w roz- kazniku) «przestaé mówié; zamilknaé» przen. Sen stulil mu ...

Mieczysław Szymczak, 1996

Słownik języka polskiego: R - T. 5 - Strona 490

STUK, u , m.; 490 STUDZIC-STULA. pil'hna manga, tromba, (cf. traba). STUDZIC cz. niedok.; Boh. studiti;`Sarab. 1. studìu, (wostudnétaediosm, wosluda taedium; Vind. aluden [rígidas: Cam. studn я czysty, klarowny; Croat. sztuden frigidus; Dal.

Samuel Bogumił Linde, 1859

Słownik języka polskiego - Tom 5 - Strona 490

33. Prawa stuly. ¡don. 76, 369 ; Vind. íbtolinga , Iblolna spoduba , nared- ba, <5tou"ge&ú{!ren. StoJa bia/a , znak nadziei. Rej. Ap.68, cf. szlak. — §. Transí, fig. Malzenstwo podlegíe odmia- nora; stula czçstokroé najzywszq miloáó oziebia. Teat.

August Bielowski, ‎Zakład narodowy imienia Ossolińskich, Lemberg, 1859

Structural and Epigenetic Analysis of the Human Genome - Strona 110

To detect this methylation pattern, we used the restriction enzyme Stul. StuI cleaves at the sequence AGGACCT, at the frequency of one per 7.66 kb, and is blocked by overlapping DCM methylation. As such, there are two possible sites of DCM ...

Gene E. Ananiev, 2008

Wplyw stanu meteorologicznego na smiertelnosc oceniony wedlug ...

obliczenia względem 4ch pór roku okazał się następujący porządek: stul. XVII stul. XVIII a. stul. XVIII b. stul. XIX. Zima Zima Zima Zima Wiosna Jesień WiOSna Wiosna Jesień Wiosna Jesień Jesień Lato Lato Lato Lato. W czém przecież nie ...

Jozef Majer, 1845

Trans-sensing Interactions and Structural Features of the Maize ...

Stul fails to cleave its recognition sequence (AGGCCT) if the more internal cytosine is methylated (Casjens et al. 1983). The Stul site at -127 (within the doppia fragment) was shown to be hypomethylated in rmrl, rmr6, and mopl mutants (Hale ...

Stephen Matthew Gross, 2007

Algorithms and Computation: 18th International Symposium, ISAAC ...

The class of languages accepted by such NL machines is denoted StUSPACE(logn) (StUL for short) by Allender and Lange [AL89]. As shown in [AL89], StUL is in fact contained in DSPACE(log 2 n/loglogn), improving the DSPACE(log 2 n) ...

Takeshi Tokuyama, 2007

The Tail Sheath of Bacteriophage N4 is Required for Adsorption to ...

GGACTGAAGCTTGCAAGAGTG C1°“'“g ORF65 mm . GCTGTCATATC pBAD/Myc--HisB. Hmdlll Reverse Primer. Cloning ORF65 NGAGGAATTAACCATGAGGCCT terminal deletions. Stul Stul TCCATTGAAGATTAC site introduction alter start ...

Jennifer A. McPartland, 2008

Opisanie roślin w Litwie, Na Wolyniu, Podolu i Ukrainie dziko ...

'I' Warga dol/sa (labellum) ost'rogowata. 474. Storczyk, Orchis. [Маш okwiam sklepisto-stulone, zieiqce; warga dolna ostrogowata; gìówki pylkoweJI 'trzonkowatm w woreczku níepodziclonym, “(Лай otwieraiqcym siç, `zamknione i poïqcvzone.

Józef Jundziłł, 1830

2 NOTICIAS EN LAS QUE SE INCLUYE EL TÉRMINO «STULIC»

Conoce de qué se habla en los medios de comunicación nacionales e internacionales y cómo se emplea el término stulic en el contexto de las siguientes noticias.

Linda Stulic: Met camera de wijde wereld in

Het is lang geleden dat ik hier ben geweest", zegt Stulic als ze met een zonnebril op haar hoofd over de Markt wandelt. Even later, wanneer ze de ober in ... «BN DeStem, Ene 12»

Johnny Stulic: 'I make music for my own soul'

The latest song Stulic has translated is Kuca na prodaju, which is a cover of Kinks' old hit House in the Country. In the song, the author Ray Davies satirically ... «Blic, Abr 11»