10 LIBRI IN POLACCO ASSOCIATI CON «UB R»
Scopri l'uso di
ub r nella seguente selezione bibliografica. Libri associati con
ub r e piccoli estratti per contestualizzare il loro uso nella letteratura.
1
Recent Trends in Data Type Specification: 10th Workshop on ...
Pj, P3 : .ub(l-) dobj(r-) / \ y fcind(x) i.(fcp)[t6] «ub(r) dobj(r) / \ .ub(r) dobj(r) X kind(x) CHAB(fcp)[K!] .»»<!•) dobj(r) / \ ub(r) dobj(r) I \ X Y .ub(r-) dobjM / \ X Y PS •• ra •• PIO-- «b(r) X \ Y .«b(r) dobj(r) / \ y cru«l(x) CHAR(kp)(Kt\ . .ub(r) dobj(r) X Jbind(x) ...
Egidio Astesiano, Gianna Reggio, Andrzej Tarlecki,
1995
2
Lasy Drugiej Rzeczpospolitej w dawnych zapisach prasowych: ...
29 stycznia 1933 r., niedziela Wystrzał w lesie Leśniczy lasów Państwowych Zygmunt Romanowski jechał 2 października ub. r. na rowerze drogą z Budziska do Czarnej Wsi. Nagle padł strzał, przyczem kula przeleciała tuż nad głową ...
3
Induction and Analysis of Antigen-Specific T Cell Responses in ...
The fusion gene Ub-M-lucNP was generated by addition of the ubiquitin gene to the 5' end of a lucNP-encoding vaccine (20). ... To generate Ub-R-lucNP, Ub-top was used together with Ub-R-bottom: 5'CTTTATGTTTTTGGCGTCTTCGCGAC ...
4
Statistique du travail - Tom 9 - Strona 46
W wyniku obustronnego porozumienia uchwalono przyznanie od 1 sierpnia ub. r. jednakowego dodatku wyrównawczego w wysokości 1,75 zł. wszystkim kategorjom robotników, którzy nie pracują w akordzie z wyjątkiem uczniów, robotników ...
Poland. Główny Urząd Statystyczny,
1930
5
Fluctuations in Physical Systems - Strona 141
V«(r, 0) = dt J - Vp(r, t) - vMn(r, t)[u(r, t) - Ub(r, t)], (11.2) where D/D/ is the convective or material time derivative, d/dt is the local or Eulerian time derivative, and t/b(r, t) is the velocity of the background flow. The thermal agitation of the particles in ...
6
Electromagnetism and quantum theory - Strona 101
We place two identical charges in the same electrostatic potential field at positions r' and r" ; for the moment, we ignore ... form with t/,(r") and N' = N", or U(r',r")= X £ CabUa(r')Ub(r"), (10-18) which can be rewritten as W, r") = I I Cab[Ua(r')Ub(r") ...
7
Elements of Computation Theory - Strona 90
What is C(N), where N is a generalized NFA with initial state p, final state r, and transitions (a) (p, b, p), (p., a, q), (q., a, q), (q., a, s), (r, b, s), (s, a, r)? (b) (p., a, q), (p, b, r), (q, b, p), (q., a, r), (r, b, q), (p. ... r), (q, a Ub, q), (q, a Ub, r), (r, a Ub', r)? 3.30.
8
Handbook of Elasticity Solutions - Strona 20
llo )+/-. llo r2 sin” a 9t2 2 uB 6°ub G W2 - + F6 = ( up r” sin” a f = p 5: where 32 2 3 V* = + + == 3r2 + r 9r is Laplacian. Lamé equations can also be rewritten, in the case of independence of displacement u from a and B, as a system of equations ...
Mark L. Kachanov, B. Shafiro, Igor Tsukrov,
2013
9
Semiclassical Standing Waves with Clustering Peaks for Nonlinear ...
It follows from (S3), (S4), (S5) and (n2) that (6.10) S-(t, Q(r, R, 360)) c Q(r, R, 380) for re [p', p), R = R" and s > 0 small. PROOF OF ... On the other hand, if T=(u) € ðQ=(p", R", ... UB(r,(u), L 4-1)) > 0. j=1 Noting # 4 do — e(L + 1) for small 6.3.
Jaeyoung Byeon, Kazunaga Tanaka,
2014
10
PIC in Practice - Strona 244
Oi <0 o O r i o f I o 1" 1 o ' > •^ ^ C*i « c i r i *• i •" 1 «"• 1 r 1 '- > r > f 1 CN» - 0. .5 1/5 * a o u «j CO g > s h- Q > H f— f— (— f— h" t— a st (— p (— a H- t« o ... sO sO sO O "« • ' 0 S. U B r*1 r«^ m r*^ ro fi sO f I C** f» <M r*i sO sO C*i m «*•! r«i ~ a.