इंग्रजी शब्दकोशामध्ये "pelf" याचा अर्थ

शब्दाची व्युत्पत्ती PELF

From Old French pelfre booty; related to Latin pilāre to despoil.

व्युत्पत्ती शब्दांच्या मुळाचा अभ्यास आणि संरचना आणि महत्त्व यांमधील बदलांचा अभ्यास आहे.

इंग्रजी मध्ये PELF चा उच्चार

pelf  [pɛlf]

इंग्रजी मध्ये PELF म्हणजे काय?

पैसे

Money

मनी कोणत्याही ऑब्जेक्ट किंवा तपासण्यायोग्य विक्रय आहे जी सामान्यत: वस्तू आणि सेवांसाठी देयक म्हणून स्वीकारली जाते आणि एखाद्या विशिष्ट देशात किंवा सामाजिक-आर्थिक संदर्भात कर्ज परतफेड म्हणून स्वीकारली जाते. पैशाचे मुख्य कार्य वेगळे आहे: एक्सचेंजचे माध्यम; खात्याची एकक; मूल्य एक स्टोअर; आणि, कधीकधी पूर्वी, स्थगित देयकांचे प्रमाण या फंक्शन्सची अंमलबजावणी करता येणारे कोणतेही ऑब्जेक्ट किंवा पडताळले जाणारे रेकॉर्ड पैसे मानले जाऊ शकते. ऐतिहासिकदृष्ट्या पैसा हा कमोडिटी मनीची स्थापना करणारा एक विक्रमी बाजारपेठ आहे, परंतु जवळजवळ सर्व समकालीन पैशांची व्यवस्था आधिकारिक पैशावर आधारित आहे. फिएट पैसे, जसे की कोणत्याही चेकची किंवा कर्जाची नोंद, भौतिक कमोडिटीच्या स्वरूपात मूळ उपयोग मूल्याशिवाय आहे सरकारची कायदेशीर निविदा असल्याचे जाहीर केल्याने त्याचे मूल्य प्राप्त होते; म्हणजेच देशभरातील सर्व देणग्या, सार्वजनिक आणि खाजगी "साठी, ही एक देयक म्हणून स्वीकारली जाणे आवश्यक आहे. अशा कायद्यात सक्तीने कोणत्याही वस्तू व सेवांची किंमत घेणे जेणेकरून त्यास त्यासंदर्भातील राष्ट्रात व्यापार करता येईल असे पैसे कमवता येतात. देशाच्या पैशांचा पुरवठा करन्सीसह होतो आणि सामान्यत: बँक पैसे समाविष्ट करते.

Money is any object or verifiable record that is generally accepted as payment for goods and services and repayment of debts in a particular country or socio-economic context. The main functions of money are distinguished as: a medium of exchange; a unit of account; a store of value; and, occasionally in the past, a standard of deferred payment. Any kind of object or verifiable record that fulfills these functions can be considered money. Money is historically an emergent market phenomenon establishing a commodity money, but nearly all contemporary money systems are based on fiat money. Fiat money, like any check or note of debt, is without intrinsic use value as a physical commodity. It derives its value by being declared by a government to be legal tender; that is, it must be accepted as a form of payment within the boundaries of the country, for "all debts, public and private". Such laws in practice cause fiat money to acquire the value of any of the goods and services that it may be traded for within the nation that issues it. The money supply of a country consists of currency and usually includes bank money.

इंग्रजी शब्दकोशातील pelf व्याख्या

शब्दकोश मध्ये पीओएफची व्याख्या म्हणजे पैसा किंवा संपत्ती, जर अप्रामाणिकपणे विकत घेतले तर; फायदे

PELF चे भाषांतर

आमच्या इंग्रजी बहुभाषी भाषांतरकर्त्यासह pelf चे 25 भाषांमधील भाषांतर शोधा.

या विभागात सादर केलेल्या इंग्रजी चा pelf इतर भाषेतली भाषांतरे स्वयंचलित सांख्यिकीय भाषांतराद्वारे प्राप्त झाली आहेत; जिथे आवश्यक भाषांतर युनिट इंग्रजी चा «pelf» हा शब्द आहे.

• भाषांतरकर्ता इंग्रजी - चीनी: PELF
• भाषांतरकर्ता इंग्रजी - स्पॅनिश: pelf
• इंग्रजी: pelf
• भाषांतरकर्ता इंग्रजी - हिन्दी: स्र्पये
• भाषांतरकर्ता इंग्रजी - अरबी: pelf
• भाषांतरकर्ता इंग्रजी - रशियन: PELF
• भाषांतरकर्ता इंग्रजी - पोर्तुगीज: pelf
• भाषांतरकर्ता इंग्रजी - बंगाली: টাকাকড়ি
• भाषांतरकर्ता इंग्रजी - फ्रेंच: lucre
• भाषांतरकर्ता इंग्रजी - मलय: Pelf
• भाषांतरकर्ता इंग्रजी - जर्मन: Moneten
• भाषांतरकर्ता इंग्रजी - जपानी: あぶく銭
• भाषांतरकर्ता इंग्रजी - कोरियन: pelf
• भाषांतरकर्ता इंग्रजी - जावानीज: Pelem
• भाषांतरकर्ता इंग्रजी - व्हिएतनामी: tiền bạc
• भाषांतरकर्ता इंग्रजी - तमिळ: pelf
• भाषांतरकर्ता इंग्रजी - मराठी: पीएलएच
• भाषांतरकर्ता इंग्रजी - तुर्की: vurgun
• भाषांतरकर्ता इंग्रजी - इटालियन: pelf
• भाषांतरकर्ता इंग्रजी - पोलिश: Pelf
• भाषांतरकर्ता इंग्रजी - युक्रेनियन: PELF
• भाषांतरकर्ता इंग्रजी - रोमानियन: parale
• भाषांतरकर्ता इंग्रजी - ग्रीक: παράδες
• भाषांतरकर्ता इंग्रजी - अफ्रिकान्स: duiten
• भाषांतरकर्ता इंग्रजी - स्वीडिश: pelf
• भाषांतरकर्ता इंग्रजी - नॉर्वेजियन: pelf

«PELF» संबंधित इंग्रजी पुस्तके

खालील ग्रंथसूची निवडीमध्ये pelf चा वापर शोधा. इंग्रजी साहित्यामध्ये वापराचा संदर्भ देण्यासाठी pelf शी संबंधित पुस्तके आणि त्याचे थोडक्यात उतारे.

Pelf - Emily's Men of Greed:

If you're reading this book and did not purchase it, or it was not purchased for your use only, then please return to Google Play and purchase your own copy. Thank you for respecting the hard work of this author. Contents Pelf About the Author ...

Derek Haines, 2014

The Collected Stories of J.A. Cummings

‚Oh, yes,‛ Pelf said. ‚I do believe in you.‛ ‚And do you believe in yourself, Pelf? If you do not, then you can never learn the secrets that I have to tell.‛ Pelf swallowed hard and searched his feelings. ‚Yes,‛ he nodded, knowing it was true.

J.A. Cummings

Walls

Jinks was impressed, and after the intense psychological screening that every potential SWAT officer receives, Pelf was placed in training. Three months later, thirty days of climbing barricades, hurdling through the obstacle course, being ...

D. C. Wilson, Nancy Rabuck Wilson, 2001

Field Guide to Freshwater Fishes of California

DESCRIPTION: Long AF ( 16 to 19 rays); prickles on skin behind PecF or over entire body; DF usually joined to one-third height of first soft ray; 1st DF = 8 to 10, 2d DF = 19 to23,PelF = 4, AF = 17 to 19; ad. SL 6 to 9 cm (2.4 to 3.5 in.), max.

Samuel M. McGinnis, 2006

Antimicrobial Therapy in Veterinary Medicine

Steeve Giguère, John F. Prescott, Patricia M. Dowling. (A) 10 + Plasma —I— PELF 1 + BAL cells DCA concentration (pg/mL) O :0 O 0.001 . I I I I I I I I I I 0 24 48 72 96 120 144 168 192 216 240 Time (h) ...

Steeve Giguère, John F. Prescott, Patricia M. Dowling, 2013

Class Politics in the Information Age

Professional Pelf While the surplus wage threshold is basic to determining the respective shares of labor and professionals in surplus wages, the average paycheck defines the lower limit of professionals' pelf comparable to capital income or ...

Donald Clark Hodges, 2000

Multidimensional NMR Methods for the Solution State

(Top) Simulation of the outcome of a DISTINCT scheme (a) with respect to a classical powder pattern (b) for a heteronuclear dipolar coupling. (Bottom) Example of the DISTINCT PELF spectrum on the headgroup and glycerol regions of lecithin ...

Gareth A. Morris, James W. Emsley, 2012

Men and Manners: A Novel

ed with the requisites tor the meal, Mrs. Pelf ordered her to call in her master. Presently Pelf returned.- " That young sellow," he said, "that- came in for debt this morning, is half distracted yonder for want of company, and praying like bewitched ...

Francis Lathom, 1800

Legionella: from protozoa to humans

Primer name Nucleotide sequence pelA cya F pelA cya R CTGCAGCTACATGAGCACACAAACAG pelB cya F pelB cya R pelD cya F pelD cya R pelE cya F pelE cya R pelF cya F GGATCCTTATGCGTAGCAGAACAGAA pelF cya R pelH cya F ...

Carmen Buchrieser

The English dialect dictionary, being the complete ...

The April hoeing, when many thistles would be, as a matter of course, cut up with the other 'pelf' (H.K.). Glo.l Car. And I raked all the pilf off the land, THOMAS Rairdiga! Rhymes (1895) 6; Cor.1 Light grass and roots raked together to be burnt; ...

Joseph Wright

नवीन गोष्टी ज्यामध्ये «PELF» ही संज्ञा समाविष्ट आहे

खालील बातम्यातील आयटमच्या संदर्भात राष्ट्रीय आणि आंतरराष्ट्रीय पत्रकार कशाबद्दल बोलले आहेत आणि pelf ही संज्ञा कशी वापरली आहे ते शोधा.

How Serious Are The Twins About 2015?

Pelf could have some value to a sub-.500 club that simply needs a guy to eat innings while treading water, but for a team like the Twins that is in ... «Twins Daily, जुलै 15»

Doling Out Thoughts

Just a cursory look at the pelf and privileges enjoyed by unelected, and far less accountable, senior government employees, makes that clear. «Outlook, जुलै 15»

Letter: GOP's future

Fat cat donors directly or indirectly derive their pelf from the availability of cheap labor from people who can survive while working for less than ... «New Bern Sun Journal, जुलै 15»

Time for BCCI to put its house in order

... has become a motley body of vested interests willing to fight or sleep with each other for power and pelf, not necessarily to the game's benefit ... «Hindustan Times, जुलै 15»

Surjya, Biman slam Mamata on corruption

... of wealth and pelf of the Trinamool leaders on each passing day, the Opposition leader and CPI(M) state secretary Surjya Kanta Mishra came ... «The Echo of India, जुलै 15»

A Ramadan story

... that their sacrifice and compassion for “their brother” will serve as a template for those who, in their insatiable greed for power, pomp and pelf, ... «Trinidad News, जुलै 15»

Learning to live with political dynasties

Dynasty: We just have to learn to live with it even if our dynasty-creating, power-kapit-tuko politicians insist on passing on positions and pelf to ... «Inquirer.net, जुलै 15»

Man who could do no wrong: N Srinivasan's charmed reign over …

There was unprecedented power and pelf at Srinivasan's disposal. Before his tenure, a BCCI president had one term of three years. In 2012, a ... «Economic Times, जुलै 15»

Love Is Blind, and So Are the Courtney Love Haters

Sorry, Courtney Love is not a blond ingenue who conned her way to fame and pelf. No, she hustled (literally, at a Times Square peep show in ... «Newsweek, जुलै 15»

Modi's honeymoon is over

The BJP, despite its RSS stream, is as steeped in the culture of manipulative politics as any other party and as tempted by the power and pelf of ... «Chandigarh Tribune, जुलै 15»