«OLIGO» संबंधित पोलिश पुस्तके
खालील ग्रंथसूची निवडीमध्ये
oligo चा वापर शोधा. पोलिश साहित्यामध्ये वापराचा संदर्भ देण्यासाठी
oligo शी संबंधित पुस्तके आणि त्याचे थोडक्यात उतारे.
1
Tomato Oligo Microarray Investigation of Exogenous Jasmonic Acid ...
These works are packaged and produced by BiblioLabs under license by ProQuest UMI.
2
Handbook of Oligo- and Polythiophenes
Handbook of ()ligo- and Polythiophenes WILEY-VCI-I Weinheim - New York- Chichester - Brisbane - Singapore -T0r0nt0 This Page Intentionally Left Blank Handbook of Oligo- and Polythiophenes Denis Fichou Handbook of Oligo- and ...
3
Successions of Meniscomyine and Allomyine Rodents (Aplodontidae) in ...
GEOLOGICAL SCIENCES Volume 124 Successions of Meniscomyine and Allomyine Rodents (Aplodontidae) in the Oligo- Miocene John Day Formation, Oregon John M. Rensberger SUCCESSIONS OF MENISCOMYINE AND ALLOMYINE ...
4
Molecular Analysis of Membrane Transporters Implicated in Drug ...
Oligo 40: ATGACCAGCAACGAGCTGCTCGAGATGAAGAAGGAGTACC Oligo 41: AGACCATCAAGGATTCAGATGTGGTCGACGTCTCCAAGAA Oligo 42: GGTCCTCATCCATGACTTCGTCTCTTCGTTGCCGGACAAG Oligo 43: ...
Jacqueline K. Lekostaj,
2008
5
Control of Transcription - Strona 361
If oligo(dT)-DNA is a nearly complete transcript of 10S RNA, then the sum total of the sizes of oligo(dG)-DNA and residual oligo(dT)-DNA [i.e., where oligo(dG) is used as primer and, at the end of the incubation, oligo(dT) is added] should not ...
6
Multiple Drug Resistance in Cancer 2: Molecular, Cellular and ...
Table I. Types and target sites of antisense directed against mdr-1 mRNA Target site Oligo type Cells used Reference –457 to —474 Phosphorothioate (PS) LoVo/Dx,S180Dx, KBCh&5 Bertram et al. –20 to –1 PS oligo CEM 6OVCR Li et al.
7
RNA Turnover in Eukaryotes: Nucleases, Pathways and Analysis of mRNA ...
The addition of too much sample RNA will interfere with the saturation of the poly(A)tail with oligo(dT) binding and ligation of adjacent oligo(dT) primers, which can cause a ''laddering'' effect on electrophoresis, or poor PCR amplification ...
Lynne E. Maquat, Megerditch Kiledjian,
2009
8
Hormones and Cancer - Strona 5
The binding to oligo (dT) - cellulose was examined with reference to the selectivity of the steroid binding macromolecule. Neither free estradiol nor heat inactivated cytosol E2R bound to oligo (dT)-cellulose. Bovine serum albumin with estradiol ...
9
Gene Cloning and Manipulation - Strona 105
In 3'RACE, reverse transcriptase synthesis of a first DNA strand is carried out using a modified oligo-dT primer. This primer comprises a stretch of unique adaptor sequence followed by an oligo-dT stretch. The first strand synthesis is followed ...
10
Peptide Nucleic Acids, Morpholinos and Related Antisense Biomolecules
Relative costs of starting materials Oligo Type Starting Material Approximate Relative Cost per Mole PNA Nucleobases 1 Morpholino Ribonucleosides 2 DNA analogs Deoxyribonucleosides 70 Oligo Assembly In regard to assembling subunits ...
Christopher Janson, Matthew During,
2006
नवीन गोष्टी ज्यामध्ये «OLIGO» ही संज्ञा समाविष्ट आहे
खालील बातम्यातील आयटमच्या संदर्भात राष्ट्रीय आणि आंतरराष्ट्रीय पत्रकार कशाबद्दल बोलले आहेत आणि
oligo ही संज्ञा कशी वापरली आहे ते शोधा.
Misael Aponte Named Oligo Professionnel International Color Director
Oligo Professionnel announces the appointment of Misael Aponte as the brand's new international color director. With experience as an educator and platform ... «ModernSalon.com, एप्रिल 15»
Le zinc, un oligo-élément important pour l'immunité
Le zinc est un oligo-élément essentiel pour de nombreux processus biologiques, comme la croissance, la fonction neurologique ou l'immunité. Il se trouve dans ... «Futura Sciences, मार्च 15»
What is the low-FODMAP diet? Is it food fad or food fact? Why you …
Oligo-saccharides include fructans (contained in wheat, rye, garlic and onion) and galacto-oligosaccharides (pulses and legumes and some nuts, particularly ... «High50, फेब्रुवारी 15»
Introducing the Dr. Oligo 48
Introducing the Dr. Oligo 48, a brand new 48 column synthesizer. Biolytic Lab Performance, Inc. has officially obtained a worldwide exclusive license to use the ... «Scientist, एक 15»
Accelerating Protein Engineering through Rational Oligo Library …
The Agilent QuikChange HT system for rational design of oligo libraries that enable rapid, large-scale mutagenesis to determine structure/function relationships ... «Genetic Engineering News, जुलै 14»
Wpływ diety o małej zawartości fermentujących oligo-, di- i …
Konsultował prof. dr hab. n. med. Witold Bartnik, Klinika Gastroenterologii i Hepatologii, Centrum Medyczne Kształcenia Podyplomowego w Warszawie. «Medycyna Praktyczna, जुलै 14»
Ahmed Elmouna: Oligos in the desert
Oligos are synthetic single-stranded DNA. Let's say we want to find out which gene is responsible for a patient's response to treatment. We then shortlist a small ... «Chemistry World, जून 14»
Y a-t-il des contre-indications à la prise d'oligo-éléments ?
"La principale contre-indication à la prise d'oligo-éléments est de le faire tout seul, n'importe comment. Ce n'est pas parce que l'on parle d'oligo-éléments qu'il ... «allodocteurs, एप्रिल 14»
Sels minéraux, oligo-éléments : des bienfaits pour tout le corps
Les minéraux et oligo-éléments sont indispensables à notre organisme, notamment à la constitution de nos os, de nos dents, de nos cheveux et de nos tissus. «allodocteurs, एप्रिल 14»
New Modifier for Improved Oligo Delivery
New Modifier for Improved Oligo Delivery. Link Technologies Ltd has expanded its range of lipophilic modifiers for the effective delivery of oligonucleotides into ... «Scientist, मार्च 14»