ஆங்கிலம்இல் CONSENSUS SEQUENCE இன் அர்த்தம் என்ன?
ஒருமித்த கருத்து
மூலக்கூறு உயிரியல் மற்றும் உயிர் தகவலியல் ஆகியவற்றில், ஒரு வரிசை வரிசைமுறையிலான ஒவ்வொரு நிலையிலும் காணப்படும் நியூக்ளியோட்டைடு அல்லது அமினோ அமிலம், பெரும்பாலும் அடிக்கடி எச்சங்களின் கணக்கிடப்பட்ட வரிசைமுறை ஆகும். இது தொடர்புடைய வரிசைமுறைகளை ஒருவருக்கொருவர் ஒப்பிடுகையில் பல தொடர் வரிசைகளின் முடிவுகளை பிரதிபலிக்கிறது, அதேபோன்ற வரிசை காட்சிகளை கணக்கிடப்படுகிறது. ஆர்.என்.ஏ பாலிமரேஸ் போன்ற தொடர் சார்ந்த நம்பகமான நொதிகளை பரிசீலிப்பதில் இத்தகைய தகவல்கள் முக்கியம்.
ஆங்கிலம் அகராதியில் consensus sequence இன் வரையறை
அகராதியிலுள்ள ஒருமித்த காட்சியின் வரையறையானது, வெவ்வேறு உயிரினங்களுக்கு பொதுவான ஒரு டி.என்.ஏ வரிசையாகும், ஒவ்வொன்றிலும் இதே போன்ற செயல்பாடு உள்ளது.
«CONSENSUS SEQUENCE» தொடர்புடைய ஆங்கிலம் புத்தகங்கள்
பின்வரும் புத்தக விவரத்தொகுப்புத் தேர்ந்தெடுப்பில்
consensus sequence இன் பயன்பாட்டைக் கண்டறியுங்கள்.
consensus sequence தொடர்பான புத்தகங்கள் மற்றும் ஆங்கிலம் இலக்கியத்தில் அதன் பயன்பாட்டுச் சூழலை வழங்குவதற்கு அதிலிருந்து பெறப்பட்ட சுருக்கமான சாரங்களைத் தொடர்புபடுத்துகின்றன.
1
Molecular Biology: Academic Cell Update Edition
The consensus sequence for the -10 sequence is TATAA and the consensus
sequence at -35 is TTGACA. (Consensus sequences are found by comparing
many sequences and taking the average.) Although a few highly expressed
genes do ...
2
Biological
Sequence Analysis Using the SeqAn C++ Library
This handy book describes a user-friendly library of efficient data types and algorithms for sequence analysis in computational biology.
Andreas Gogol-Döring, Knut Reinert,
2009
3
Bacteria from Fish and Other Aquatic Animals: A Practical ...
Once both are checked a consensus sequence can be obtained. First select the
duplicate sequence by clicking in the left-hand window to highlight the sequence
name. Go to the menu bar and EDIT, COPY SEQUENCE. Then click on the ...
4
Sequence Analysis Primer
A simple consensus sequence, with the most common base at each position and
ambiguity codes where there is a choice of two or three bases, can be useful if
the site is well conserved, for example, splice site donor- acceptor sequences.
5
Metallothionein in Biology and Medicine
55-00000-976775 MRE consensus sequence CTNTGCRCNCGGCCC
GCACGGCCCC ACGCTGTGCGCACCGCCT CGCAGCGC
GCACCGCCCCGCCGTGCGCTGCGCGCAGCA CCACCCCG Spl consensus
GCTCCGCCCC sequence ...
6
Protein-DNA Interactions: Characterization of a Definitive ...
The PCR amplified product of the EMSA selection stage was then subcloned and
sequenced and the data obtained analyzed to determine a definitive consensus
sequence at the half sites. The experimental design is summarized in scheme 1.
7
Lewin's Essential Genes
At the k locus, each Vk gene segment is followed by a consensus sequence with
a 12 sequences (RSS) The combinations of heptamer- spacer-nonamer
consensus sequence that are required bp spacer. Each Jk segment is preceded
by a ...
Jocelyn E. Krebs, Benjamin Lewin, Elliott S. Goldstein,
2013
8
String Processing and Information Retrieval: 15th ...
isamotif set ifthereexists a consensus sequence, s∗.Wesay set S isadecoy set if S
ispairwise bounded but does nothaveaconsensus. These problems –
motifrecognition and Consensus Sequence – havean extensive number
ofapplications, ...
Amihood Amir, Andrew Turpin, Alistair Moffat,
2008
9
Automation: Genomic and Functional Analyses
Genomic and Functional Analyses Alister G. Craig, Jörg D. Hoheisel. The output
of an assembly program, viewed in an editor, is a set of "contig layouts" in which
overlapping sequence reads, the consensus sequence derived from these reads,
...
Alister G. Craig, Jörg D. Hoheisel,
1999
10
THE INITIATION OF DNA REPLICATION Z
APPENDIX THE CONSENSUS SEQUENCE OF THE BACTERIAL ORIGIN Judith
W. Zyskind and Douglas W. Smith Department of Biology, C—Ol6, University of
California at San Diego, La Jolla, California 92093 Yukinori Hirota National ...
«CONSENSUS SEQUENCE» வார்த்தையைக் கொண்டுள்ள புதிய உருப்படிகள்
பின்வரும் செய்தி உருப்படிகளின் சூழலில்
consensus sequence என்ற வார்த்தையைப் பயன்படுத்துவது பற்றியும் எப்படிப் பயன்படுத்துவது என்பதைப் பற்றியும் தேசிய மற்றும் பன்னாட்டு அச்சகங்கள் என்ன பேசியிருக்கின்றன என்பதைக் கண்டறியுங்கள்.
Viral assemblage composition in Yellowstone acidic hot springs …
The high stringency assemblies ensure that each contig corresponds to a single viral genotype rather than a consensus sequence. This allows ... «Nature.com, ஜூன் 15»
Integrin α1β1 expression is controlled by c-MYC in colorectal cancer …
Bases in bold are common with the consensus sequence bases in the wild-type promoter. The gray boxes represent site disruption (M-BOX-S1 ... «Nature.com, ஜூன் 15»
FOXM1 binds directly to non-consensus sequences in the human …
... polarization assay identified point mutations in the DNA binding domain of FOXM1 that inhibit binding to a FKH consensus sequence. «7thSpace Interactive, ஜூன் 15»
Strand-specific RNA sequencing in Plasmodium falciparum malaria …
... extra GTAG in the predicted sequence marks the non-canonical ARP_circRNA splice junction (highlighted in red in the consensus sequence). «BMC Blogs Network, ஜூன் 15»
Improved detection of Escherichia coli and coliform bacteria by …
coli by multiplex PCR. A consensus sequence of lacZ and the orphan gene yaiO were chosen as targets for amplification, yielding 234Â bp and ... «7thSpace Interactive, ஜூன் 15»
CTCF as a multifunctional protein in genome regulation and gene …
CTCF is known to bind a CpG-rich consensus sequence that is usually unmethylated, as CTCF preferentially binds to unmethylated elements, ... «Nature.com, ஜூன் 15»
HEDGEHOG/GLI-E2F1 axis modulates iASPP expression and …
Bioinformatic analysis did not identify any canonical GLI consensus sequence (GACCACCCA) in the E2F1 promoter. However, GLI ... «Nature.com, மே 15»
TP53 transcription factor for the NEDD9/HEF1/Cas-L gene: potential …
An already relatively high fixation of the p53 protein on the consensus sequence could be observed in control cells. However, when treated ... «Nature.com, மே 15»
A genetic basis for human centromeres
The authors then generated a consensus sequence for each group: Cen1-like and Cen13-like. Several sequences also matched unplaced ... «Fred Hutch News Service, மே 15»
CGGBP1 mitigates cytosine methylation at repetitive DNA sequences
... (amplicon size 220 bps from Alu consensus sequence), and ATTTTTGTATTTTTATTTGAGGTAT and AACTATAATAAACTCCACCCAATTC for ... «BMC Blogs Network, மே 15»