AGÁT SÖZCÜĞÜ ROMENCE DİLİNDE NE ANLAMA GELİR?
Romence sözlükte «agát» sözcüğünün
özgün tanımını görmek için tıklayın.
Tanımın Türkçe diline
otomatik çevirisini görmek için tıklayın.
Romence sözlükte agát sözcüğünün tanımı
Agate n., Pl. e ve (nadiren) akik f., pl. Sicilya'da bir nehrin adı olan achata, agate, d. lat., vd ahátes, agat). Farklı renklerden [!] (Mavi, kırmızı) oluşan konsantrik ve cilalı alanlı bir kuvartz türü. \u0026 # X2013; Sonradan söylendi ve ah, dedi. V. Kaleiçisi. agát n., pl. e, și (maĭ rar) agátă f., pl. e (fr. agate, it. ágata, d. lat. achátes [care era și numele unuĭ rîu din Sicilia], d. vgr. ahátes, agat). Un fel de cuarț care constitue o peatră [!] de diferite colorĭ [!] (albastră, roșie) cu zone concentrice și care se poate lustrui frumos. – Se zicea și ahát, după ngr. V. calcedonie.
Romence sözlükte «agát» sözcüğünün
özgün tanımını görmek için tıklayın.
Tanımın Türkçe diline
otomatik çevirisini görmek için tıklayın.
«AGÁT» İLE İLİŞKİLİ ROMENCE KİTAPLAR
agát sözcüğünün kullanımını aşağıdaki kaynakça seçkisinde keşfedin.
agát ile ilişkili kitaplar ve Romence edebiyattaki kullanımı ile ilgili bağlam sağlaması için küçük metinler.
1
Ioannis Sperlingii ... Disquisitio an virgula mercurialis ...
__ "iiyiraaieataea, _gaa ia aarïadiaia vtaaiar, ' Ё » ' agat ex aaai/_ka qaalitate? j l ' ' ' - ‚я- _ - .VIL ' ‚ dúèe'rel vellè nimium _iqdícamusf pau-ci anim, vt anteconf `. чает Гцшцз, de_fola voce quicquam meminemnt.; ладит, de tota quaeffidne: ...
2
Advanced Topics in Forensic DNA Typing: Methodology: ... - Pagina 588
d12s391 (Continued) Allele (repeat #) Promega ESX 17 Promega ESI 17 ABI NGM repeat Structure [AGAT]n{GAT}0–1(AGAC)m [AGAT]0–1 reference 22 (a) 162 bp 323 bp 262 bp [AGAT]15(AGAC)6AGAT Lareu et al. (1996) 22 (b) 162 bp 323 ...
3
Cellular Bioenergetics: Role of Coupled Creatine Kinases - Pagina 55
L-Arg and guanidinoacetate have only apparent repressor activity, since they have no effect on AGAT expression by themselves, but are readily converted into Cr which then acts as the true repressor. Since the half-life of AGAT in rat kidney is ...
Valdur A. Saks, Renée VENTURA, 2012
4
Impreasin na Gaeilge I – Z: (Fuaim na Gaeilge)
má tá aon eolas agat mar gheall air má tá aon fhreagra agat má tá aon ghá ag éinne leis [Seanchas Chléire 1977: 60] má tá aon iarratas agat le dul leis má tá aon tuairimí agat má tá breis eolais uait má tá cúpla deoch uathu má tá éileamh air ...
Seosamh Mac Ionnrachtaigh, 2015
5
A 6th Bowl of Chicken Soup for the Soul: More Stories to ...
“Agat!” Lori called, scooping her up as the director explained to the little girl that a doctor far away would make her better. Agat looked at Lori, her wide eyes full of hope. “I'll take care of you,” Lori cooed. As Agat smiled, Lori's heart melted.
Jack Canfield, Mark Victor Hansen, 2012
6
Genealogy Online For Dummies
Now see whetheryou canmake senseofa realsequence ofbases for the marker DYS393, keeping in mind that you can refer to the book example if needed: gtggtcttctacttgtgtcaatac AGAT AGAT AGAT AGAT AGAT AGAT AGAT AGAT AGAT AGAT ...
April Leigh Helm, Matthew L. Helm, 2014
7
Sequence Stratigraphy on the Northwest European Margin: ...
Within the Agat area, seismic anomalies/mounds have been recognized on an Intra-Albian unconformity. The sedimentological analyses of cores from the Agat Formation indicate, in contrast to published interpretations of depositional ...
Norsk petroleumsforening. Conference, R. J. Steel, 1995
8
Computer - Human Interaction in Symbolic Computation - Pagina 169
3.3 How to instrument the source code There are some simple guidelines on how to instrument the code that should be followed to make the best use of the features of Agat. Contrary to most algorithm animation systems Agat enables the user ...
9
Results of Monitoring Study of Agat Harbor, Guam - Pagina A-2
I. TITLE – Modification to Delivery Order #33 DACW39–88-D-0059 Study of Currents at Agat Harbor, Guam. II. DESCRIPTION: The Monitoring Completed Coastal Projects (MCCP) work at Agat Harbor, Guam, includes monitoring the currents ...
David D. Mcgehee, Stanley J. Boc, 1997
10
DNA and Social Networking: A Guide to Genealogy in the ... - Pagina 24
On marker DYS393, for example, many men have a series of thirteen repeats of the letters AGAT: CTGTCTG AGAT AGAT AGAT AGAT AGAT AGAT AGAT AGAT AGAT AGAT AGAT AGAT AGAT TCTGCC The number of repeats is counted on ...
«AGÁT» TERİMİNİ İÇEREN HABERLER
Ulusal ve uluslararası basında konuşulanları ve
agát teriminin aşağıdaki haberlerde hangi bağlamda kullanıldığını keşfedin.
Urastený Agát pod Slavínom
Rezidencia pod Slavínom Agát je jednou z nich.Umiestnenie bytového domu medzi rodinnými za väčšinu okolností kritizujeme. Tento projekt však vďaka svojej ... «TREND.sk, Mar 15»
Agát: Byty medzi rodinnými domami
Agát – Rezidencia pod Slavínom vyrástla medzi rodinnými domami. Hoci väčšinou by sme takýto urbanizmus skritizovali, táto novostavba vďaka svojej bielej ... «TREND.sk, Şub 15»
Agát pod Slavínom dokončili pred dvoma rokmi, voľných je zopár bytov
Pod bratislavským Slavínom predvlani dokončili projekt Agát, ktorý naďalej ponúka niekoľko voľných bytov. Za novostavbou s 21 bytmi a bielou fasádou na ... «TREND.sk, Oca 15»
Slovensko zlikviduje kazetovú muníciu, pristúpi k dohovoru
Konkrétne je to 602 rakiet typu 122 JRKK-AGÁT (nadobúdacia hodnota jednej rakety bola 3 952,67 eur, celkom 2 379 507,34 eur), 67 kontajnerov MLRS M-26 ... «Webnoviny.sk, Oca 14»
Miroslav Pivoda: Agent StB „Akát“
Honza, který mne do svazků StB v květnu 1989 zapsal, asi nebyl silný v české gramatice, a proto použil jednou výraz „Akát“ a na jiném místě „Agát“. «ParlamentníListy.cz, Kas 13»
Sladučký agátový med
Agát neumývame.Tak ako sme nazbierali(z čistejšieho prostredia),hned sním pracujeme dalej.Do jednej velkej misy stiahneme rukou z každého strapčeka ... «Pravda.sk, May 13»
Hanychová trpěla laktační psychózou. Bláznivá modelka se tak …
Pohled na deset naklonovaných Agát Hanychových byl pro přihlížející návštěvníky dost bizarní. Hosté na večírku si okamžitě začali špitat, že se strašidelná ... «Super.cz, Ara 11»