Bedeutung von "stulic" im Wörterbuch Polnisch

AUSSPRACHE VON STULIC AUF POLNISCH

stulic

ÜBERSETZUNG VON STULIC

Erfahre, wie die Übersetzung von stulic auf 25 Sprachen mit unserem mehrsprachigen Übersetzer Polnisch lautet.

Die Übersetzungen von stulic auf andere Sprachen, die in diesem Bereich vorgestellt werden, sind zustande gekommen durch automatische statistische Übersetzung, wobei die Basiseinheit der Übersetzung das Wort «stulic» in Polnisch ist.

• Übersetzer Deutsch - Chinesisch: stulić
• Übersetzer Deutsch - Spanisch: Štulić
• Übersetzer Deutsch - Englisch: stulić
• Übersetzer Deutsch - Hindi: stulić
• Übersetzer Deutsch - Arabisch: stulić
• Übersetzer Deutsch - Russisch: stulić
• Übersetzer Deutsch - Portugiesisch: stulić
• Übersetzer Deutsch - Bengalisch: stulić
• Übersetzer Deutsch - Französisch: stulić
• Übersetzer Deutsch - Malaysisch: Stulic
• Übersetzer Deutsch - Deutsch: Stulić
• Übersetzer Deutsch - Japanisch: stulić
• Übersetzer Deutsch - Koreanisch: stulić
• Übersetzer Deutsch - Javanisch: stulić
• Übersetzer Deutsch - Vietnamesisch: stulić
• Übersetzer Deutsch - Tamil: stulić
• Übersetzer Deutsch - Marathi: stulić
• Übersetzer Deutsch - Türkisch: stulić
• Übersetzer Deutsch - Italienisch: Stulic
• Polnisch: stulic
• Übersetzer Deutsch - Ukrainisch: stulić
• Übersetzer Deutsch - Rumänisch: stulić
• Übersetzer Deutsch - Griechisch: stulić
• Übersetzer Deutsch - Afrikaans: stulić
• Übersetzer Deutsch - Schwedisch: stulić
• Übersetzer Deutsch - Norwegisch: stulić

10 BÜCHER, DIE MIT «STULIC» IM ZUSAMMENHANG STEHEN

Entdecke den Gebrauch von stulic in der folgenden bibliographischen Auswahl. Bücher, die mit stulic im Zusammenhang stehen und kurze Auszüge derselben, um seinen Gebrauch in der Literatur kontextbezogen darzustellen.

Shake, Rattle and Roll: Yugoslav Rock Music and the Poetics of ...

Štulić's peripherality to the narrative, thus, is by no means suggestive of him being marginal to the world, that is, being detached from and lost in it. On the contrary, it is his poetical marginality that is the source of his full awareness of the world, ...

Dalibor Mišina, 2016

Słownik języka polskiego - Tom 3 - Strona 335

Kort stula uszy. Pies stulil ogon. Motyl stulil skrzydta. Stulone ptatki rózy. O fraz. Stulic uszy «staé sic potulnym, pokomym; prze- straszyé sie» O posp. Stulié gebç, pysk (zwykle w roz- kazniku) «przestaé mówié; zamilknaé» przen. Sen stulil mu ...

Mieczysław Szymczak, 1996

Słownik języka polskiego: R - T. 5 - Strona 490

STUK, u , m.; 490 STUDZIC-STULA. pil'hna manga, tromba, (cf. traba). STUDZIC cz. niedok.; Boh. studiti;`Sarab. 1. studìu, (wostudnétaediosm, wosluda taedium; Vind. aluden [rígidas: Cam. studn я czysty, klarowny; Croat. sztuden frigidus; Dal.

Samuel Bogumił Linde, 1859

Słownik języka polskiego - Tom 5 - Strona 490

33. Prawa stuly. ¡don. 76, 369 ; Vind. íbtolinga , Iblolna spoduba , nared- ba, <5tou"ge&ú{!ren. StoJa bia/a , znak nadziei. Rej. Ap.68, cf. szlak. — §. Transí, fig. Malzenstwo podlegíe odmia- nora; stula czçstokroé najzywszq miloáó oziebia. Teat.

August Bielowski, ‎Zakład narodowy imienia Ossolińskich, Lemberg, 1859

Structural and Epigenetic Analysis of the Human Genome - Strona 110

To detect this methylation pattern, we used the restriction enzyme Stul. StuI cleaves at the sequence AGGACCT, at the frequency of one per 7.66 kb, and is blocked by overlapping DCM methylation. As such, there are two possible sites of DCM ...

Gene E. Ananiev, 2008

Wplyw stanu meteorologicznego na smiertelnosc oceniony wedlug ...

obliczenia względem 4ch pór roku okazał się następujący porządek: stul. XVII stul. XVIII a. stul. XVIII b. stul. XIX. Zima Zima Zima Zima Wiosna Jesień WiOSna Wiosna Jesień Wiosna Jesień Jesień Lato Lato Lato Lato. W czém przecież nie ...

Jozef Majer, 1845

Trans-sensing Interactions and Structural Features of the Maize ...

Stul fails to cleave its recognition sequence (AGGCCT) if the more internal cytosine is methylated (Casjens et al. 1983). The Stul site at -127 (within the doppia fragment) was shown to be hypomethylated in rmrl, rmr6, and mopl mutants (Hale ...

Stephen Matthew Gross, 2007

Algorithms and Computation: 18th International Symposium, ISAAC ...

The class of languages accepted by such NL machines is denoted StUSPACE(logn) (StUL for short) by Allender and Lange [AL89]. As shown in [AL89], StUL is in fact contained in DSPACE(log 2 n/loglogn), improving the DSPACE(log 2 n) ...

Takeshi Tokuyama, 2007

The Tail Sheath of Bacteriophage N4 is Required for Adsorption to ...

GGACTGAAGCTTGCAAGAGTG C1°“'“g ORF65 mm . GCTGTCATATC pBAD/Myc--HisB. Hmdlll Reverse Primer. Cloning ORF65 NGAGGAATTAACCATGAGGCCT terminal deletions. Stul Stul TCCATTGAAGATTAC site introduction alter start ...

Jennifer A. McPartland, 2008

Opisanie roślin w Litwie, Na Wolyniu, Podolu i Ukrainie dziko ...

'I' Warga dol/sa (labellum) ost'rogowata. 474. Storczyk, Orchis. [Маш okwiam sklepisto-stulone, zieiqce; warga dolna ostrogowata; gìówki pylkoweJI 'trzonkowatm w woreczku níepodziclonym, “(Лай otwieraiqcym siç, `zamknione i poïqcvzone.

Józef Jundziłł, 1830

2 NACHRICHTEN, IN DENEN DER BEGRIFF «STULIC» VORKOMMT

Erfahre, worüber man in den einheimischen und internationalen Medien spricht und wie der Begriff stulic im Kontext der folgenden Nachrichten gebraucht wird.

Linda Stulic: Met camera de wijde wereld in

Het is lang geleden dat ik hier ben geweest", zegt Stulic als ze met een zonnebril op haar hoofd over de Markt wandelt. Even later, wanneer ze de ober in ... «BN DeStem, Jan 12»

Johnny Stulic: 'I make music for my own soul'

The latest song Stulic has translated is Kuca na prodaju, which is a cover of Kinks' old hit House in the Country. In the song, the author Ray Davies satirically ... «Blic, Apr 11»