10 LIVRES EN POLONAIS EN RAPPORT AVEC «STULIC»
Découvrez l'usage de
stulic dans la sélection bibliographique suivante. Des livres en rapport avec
stulic et de courts extraits de ceux-ci pour replacer dans son contexte son utilisation littéraire.
1
Shake, Rattle and Roll: Yugoslav Rock Music and the Poetics of ...
Štulić's peripherality to the narrative, thus, is by no means suggestive of him being marginal to the world, that is, being detached from and lost in it. On the contrary, it is his poetical marginality that is the source of his full awareness of the world, ...
2
Słownik języka polskiego - Tom 3 - Strona 335
Kort stula uszy. Pies stulil ogon. Motyl stulil skrzydta. Stulone ptatki rózy. O fraz. Stulic uszy «staé sic potulnym, pokomym; prze- straszyé sie» O posp. Stulié gebç, pysk (zwykle w roz- kazniku) «przestaé mówié; zamilknaé» przen. Sen stulil mu ...
Mieczysław Szymczak,
1996
3
Słownik języka polskiego: R - T. 5 - Strona 490
STUK, u , m.; 490 STUDZIC-STULA. pil'hna manga, tromba, (cf. traba). STUDZIC cz. niedok.; Boh. studiti;`Sarab. 1. studìu, (wostudnétaediosm, wosluda taedium; Vind. aluden [rígidas: Cam. studn я czysty, klarowny; Croat. sztuden frigidus; Dal.
Samuel Bogumił Linde,
1859
4
Słownik języka polskiego - Tom 5 - Strona 490
33. Prawa stuly. ¡don. 76, 369 ; Vind. íbtolinga , Iblolna spoduba , nared- ba, <5tou"ge&ú{!ren. StoJa bia/a , znak nadziei. Rej. Ap.68, cf. szlak. — §. Transí, fig. Malzenstwo podlegíe odmia- nora; stula czçstokroé najzywszq miloáó oziebia. Teat.
August Bielowski, Zakład narodowy imienia Ossolińskich, Lemberg,
1859
5
Structural and Epigenetic Analysis of the Human Genome - Strona 110
To detect this methylation pattern, we used the restriction enzyme Stul. StuI cleaves at the sequence AGGACCT, at the frequency of one per 7.66 kb, and is blocked by overlapping DCM methylation. As such, there are two possible sites of DCM ...
6
Wplyw stanu meteorologicznego na smiertelnosc oceniony wedlug ...
obliczenia względem 4ch pór roku okazał się następujący porządek: stul. XVII stul. XVIII a. stul. XVIII b. stul. XIX. Zima Zima Zima Zima Wiosna Jesień WiOSna Wiosna Jesień Wiosna Jesień Jesień Lato Lato Lato Lato. W czém przecież nie ...
7
Trans-sensing Interactions and Structural Features of the Maize ...
Stul fails to cleave its recognition sequence (AGGCCT) if the more internal cytosine is methylated (Casjens et al. 1983). The Stul site at -127 (within the doppia fragment) was shown to be hypomethylated in rmrl, rmr6, and mopl mutants (Hale ...
Stephen Matthew Gross,
2007
8
Algorithms and Computation: 18th International Symposium, ISAAC ...
The class of languages accepted by such NL machines is denoted StUSPACE(logn) (StUL for short) by Allender and Lange [AL89]. As shown in [AL89], StUL is in fact contained in DSPACE(log 2 n/loglogn), improving the DSPACE(log 2 n) ...
9
The Tail Sheath of Bacteriophage N4 is Required for Adsorption to ...
GGACTGAAGCTTGCAAGAGTG C1°“'“g ORF65 mm . GCTGTCATATC pBAD/Myc--HisB. Hmdlll Reverse Primer. Cloning ORF65 NGAGGAATTAACCATGAGGCCT terminal deletions. Stul Stul TCCATTGAAGATTAC site introduction alter start ...
Jennifer A. McPartland,
2008
10
Opisanie roślin w Litwie, Na Wolyniu, Podolu i Ukrainie dziko ...
'I' Warga dol/sa (labellum) ost'rogowata. 474. Storczyk, Orchis. [Маш okwiam sklepisto-stulone, zieiqce; warga dolna ostrogowata; gìówki pylkoweJI 'trzonkowatm w woreczku níepodziclonym, “(Лай otwieraiqcym siç, `zamknione i poïqcvzone.
2 ACTUALITÉS CONTENANT LE TERME «STULIC»
Découvrez de quoi on parle dans les médias nationaux et internationaux et comment le terme
stulic est employé dans le contexte des actualités suivantes.
Linda Stulic: Met camera de wijde wereld in
Het is lang geleden dat ik hier ben geweest", zegt Stulic als ze met een zonnebril op haar hoofd over de Markt wandelt. Even later, wanneer ze de ober in ... «BN DeStem, janv 12»
Johnny Stulic: 'I make music for my own soul'
The latest song Stulic has translated is Kuca na prodaju, which is a cover of Kinks' old hit House in the Country. In the song, the author Ray Davies satirically ... «Blic, avril 11»