CĂRȚI ÎN POLONEZĂ ÎN LEGĂTURĂ CU «OLIGO»
Descoperă întrebuințarea
oligo în următoarea selecție bibliografică. Cărți în legătură cu
oligo și extrase din aceasta pentru a furniza contextul de întrebuințare al acestuia în literatura Poloneză.
1
Tomato Oligo Microarray Investigation of Exogenous Jasmonic Acid ...
These works are packaged and produced by BiblioLabs under license by ProQuest UMI.
2
Handbook of Oligo- and Polythiophenes
Handbook of ()ligo- and Polythiophenes WILEY-VCI-I Weinheim - New York- Chichester - Brisbane - Singapore -T0r0nt0 This Page Intentionally Left Blank Handbook of Oligo- and Polythiophenes Denis Fichou Handbook of Oligo- and ...
3
Successions of Meniscomyine and Allomyine Rodents (Aplodontidae) in ...
GEOLOGICAL SCIENCES Volume 124 Successions of Meniscomyine and Allomyine Rodents (Aplodontidae) in the Oligo- Miocene John Day Formation, Oregon John M. Rensberger SUCCESSIONS OF MENISCOMYINE AND ALLOMYINE ...
4
Molecular Analysis of Membrane Transporters Implicated in Drug ...
Oligo 40: ATGACCAGCAACGAGCTGCTCGAGATGAAGAAGGAGTACC Oligo 41: AGACCATCAAGGATTCAGATGTGGTCGACGTCTCCAAGAA Oligo 42: GGTCCTCATCCATGACTTCGTCTCTTCGTTGCCGGACAAG Oligo 43: ...
Jacqueline K. Lekostaj, 2008
5
Control of Transcription - Strona 361
If oligo(dT)-DNA is a nearly complete transcript of 10S RNA, then the sum total of the sizes of oligo(dG)-DNA and residual oligo(dT)-DNA [i.e., where oligo(dG) is used as primer and, at the end of the incubation, oligo(dT) is added] should not ...
6
Multiple Drug Resistance in Cancer 2: Molecular, Cellular and ...
Table I. Types and target sites of antisense directed against mdr-1 mRNA Target site Oligo type Cells used Reference –457 to —474 Phosphorothioate (PS) LoVo/Dx,S180Dx, KBCh&5 Bertram et al. –20 to –1 PS oligo CEM 6OVCR Li et al.
7
RNA Turnover in Eukaryotes: Nucleases, Pathways and Analysis of mRNA ...
The addition of too much sample RNA will interfere with the saturation of the poly(A)tail with oligo(dT) binding and ligation of adjacent oligo(dT) primers, which can cause a ''laddering'' effect on electrophoresis, or poor PCR amplification ...
Lynne E. Maquat, Megerditch Kiledjian, 2009
8
Hormones and Cancer - Strona 5
The binding to oligo (dT) - cellulose was examined with reference to the selectivity of the steroid binding macromolecule. Neither free estradiol nor heat inactivated cytosol E2R bound to oligo (dT)-cellulose. Bovine serum albumin with estradiol ...
9
Gene Cloning and Manipulation - Strona 105
In 3'RACE, reverse transcriptase synthesis of a first DNA strand is carried out using a modified oligo-dT primer. This primer comprises a stretch of unique adaptor sequence followed by an oligo-dT stretch. The first strand synthesis is followed ...
10
Peptide Nucleic Acids, Morpholinos and Related Antisense Biomolecules
Relative costs of starting materials Oligo Type Starting Material Approximate Relative Cost per Mole PNA Nucleobases 1 Morpholino Ribonucleosides 2 DNA analogs Deoxyribonucleosides 70 Oligo Assembly In regard to assembling subunits ...
Christopher Janson, Matthew During, 2006
ȘTIRI NOI CARE INCLUD TERMENUL «OLIGO»
Află ce ziare naționale și internaționale au scris despre și cum este întrebuințat termenul
oligo în contextul următoarelor știri.
Misael Aponte Named Oligo Professionnel International Color Director
Oligo Professionnel announces the appointment of Misael Aponte as the brand's new international color director. With experience as an educator and platform ... «ModernSalon.com, Apr 15»
Le zinc, un oligo-élément important pour l'immunité
Le zinc est un oligo-élément essentiel pour de nombreux processus biologiques, comme la croissance, la fonction neurologique ou l'immunité. Il se trouve dans ... «Futura Sciences, Mar 15»
What is the low-FODMAP diet? Is it food fad or food fact? Why you …
Oligo-saccharides include fructans (contained in wheat, rye, garlic and onion) and galacto-oligosaccharides (pulses and legumes and some nuts, particularly ... «High50, Feb 15»
Introducing the Dr. Oligo 48
Introducing the Dr. Oligo 48, a brand new 48 column synthesizer. Biolytic Lab Performance, Inc. has officially obtained a worldwide exclusive license to use the ... «Scientist, Ian 15»
Accelerating Protein Engineering through Rational Oligo Library …
The Agilent QuikChange HT system for rational design of oligo libraries that enable rapid, large-scale mutagenesis to determine structure/function relationships ... «Genetic Engineering News, Iul 14»
Wpływ diety o małej zawartości fermentujących oligo-, di- i …
Konsultował prof. dr hab. n. med. Witold Bartnik, Klinika Gastroenterologii i Hepatologii, Centrum Medyczne Kształcenia Podyplomowego w Warszawie. «Medycyna Praktyczna, Iul 14»
Ahmed Elmouna: Oligos in the desert
Oligos are synthetic single-stranded DNA. Let's say we want to find out which gene is responsible for a patient's response to treatment. We then shortlist a small ... «Chemistry World, Iun 14»
Y a-t-il des contre-indications à la prise d'oligo-éléments ?
"La principale contre-indication à la prise d'oligo-éléments est de le faire tout seul, n'importe comment. Ce n'est pas parce que l'on parle d'oligo-éléments qu'il ... «allodocteurs, Apr 14»
Sels minéraux, oligo-éléments : des bienfaits pour tout le corps
Les minéraux et oligo-éléments sont indispensables à notre organisme, notamment à la constitution de nos os, de nos dents, de nos cheveux et de nos tissus. «allodocteurs, Apr 14»
New Modifier for Improved Oligo Delivery
New Modifier for Improved Oligo Delivery. Link Technologies Ltd has expanded its range of lipophilic modifiers for the effective delivery of oligonucleotides into ... «Scientist, Mar 14»
