Bedeutung von "amplify" im Wörterbuch Englisch

ETYMOLOGIE DES WORTES AMPLIFY

From Old French amplifier, ultimately from Latin amplificāre to enlarge, from amplus spacious + facere to make.

Als Etymologie wird die Wissenschaft von der Herkunft von Wörtern und deren Struktur- und Bedeutungsänderungen bezeichnet.

AUSSPRACHE VON AMPLIFY AUF ENGLISCH

amplify  [ˈæmplɪˌfaɪ]

GRAMMATIKALISCHE KATEGORIE VON AMPLIFY

Amplify ist ein Verb.

Das Verb ist derjenige Teil des Satzes, der konjugiert wird und der Handlung und Zustand ausdrückt.

Siehe die Konjugation des verbs amplify auf Englisch.

WAS BEDEUTET AMPLIFY AUF ENGLISCH

Verstärkung

Amplification

Die Verstärkung kann sich beziehen auf: ▪ Der Betrieb eines Verstärkers, einer natürlichen oder künstlichen Vorrichtung, die ein Signal stärker machen soll. ▪ Amplify, ein NY-basierter All-Rights-Film-Distributor. ▪ Verstärkung, eine Redeweise, die die rhetorische Wirkung verstärkt ▪ Verstärkung, bei der körperliche Symptome vom psychologischen Zustand betroffen sind ▪ Verstärkung, ein Mechanismus, der zu mehreren Kopien einer chromosomalen Region innerhalb eines Chromosomenarms führt ▪ Die DNA - Amplifikationstechnik der Polymerase-Kettenreaktion in der Molekularbiologie, eine Labormethode zur Erstellung mehrerer Kopien von kleinen Segmenten von DNA Amplified kann sich beziehen auf: ▪ Amplified, ein Album von Q-Tip ▪ Amplified, ein Album von Mock Orange ▪ Verstärkt // Eine Dekade, Cello, ein Album von Apocalyptica ▪ Verstärkt, eine Hong Kong Rockband in Japan beliebt.

Amplification may refer to: ▪ The operation of an amplifier, a natural or artificial device intended to make a signal stronger. ▪ Amplify, a NY-based all-rights film distributor. ▪ Amplification, a figure of speech that adds importance to increase its rhetorical effect ▪ Amplification in which physical symptoms are affected by psychological state ▪ Amplification, a mechanism leading to multiple copies of a chromosomal region within a chromosome arm ▪ The DNA amplification technique of the polymerase chain reaction in molecular biology, a laboratory method for creating multiple copies of small segments of DNA Amplified may refer to: ▪ Amplified, an album by Q-Tip ▪ Amplified, an album by Mock Orange ▪ Amplified // A Decade of Reinventing the Cello, an album by Apocalyptica ▪ Amplified, a Hong Kong rock band popular in Japan.

Definition von amplify im Wörterbuch Englisch

Die erste Definition von amplify im Wörterbuch ist die Vergrößerung, Ausdehnung, Wirkung etc., wie durch die Zugabe von zusätzlichem Material; vermehren; vergrößern; erweitern. Eine andere Definition von amplify ist die Amplifikation von; Erhöhen Sie die Amplitude von. Amplify ist auch zu übertreiben.

KONJUGATION AUF ENGLISCH DES VERBS AMPLIFY

PRESENT

Present

I amplify

you amplify

he/she/it amplifies

we amplify

you amplify

they amplify

Present continuous

I am amplifying

you are amplifying

he/she/it is amplifying

we are amplifying

you are amplifying

they are amplifying

Present perfect

I have amplified

you have amplified

he/she/it has amplified

we have amplified

you have amplified

they have amplified

Present perfect continuous

I have been amplifying

you have been amplifying

he/she/it has been amplifying

we have been amplifying

you have been amplifying

they have been amplifying

PAST

Past

I amplified

you amplified

he/she/it amplified

we amplified

you amplified

they amplified

Past continuous

I was amplifying

you were amplifying

he/she/it was amplifying

we were amplifying

you were amplifying

they were amplifying

Past perfect

I had amplified

you had amplified

he/she/it had amplified

we had amplified

you had amplified

they had amplified

Past perfect continuous

I had been amplifying

you had been amplifying

he/she/it had been amplifying

we had been amplifying

you had been amplifying

they had been amplifying

FUTURE

Future

I will amplify

you will amplify

he/she/it will amplify

we will amplify

you will amplify

they will amplify

Future continuous

I will be amplifying

you will be amplifying

he/she/it will be amplifying

we will be amplifying

you will be amplifying

they will be amplifying

Future perfect

I will have amplified

you will have amplified

he/she/it will have amplified

we will have amplified

you will have amplified

they will have amplified

Future perfect continuous

I will have been amplifying

you will have been amplifying

he/she/it will have been amplifying

we will have been amplifying

you will have been amplifying

they will have been amplifying

CONDITIONAL

Conditional

I would amplify

you would amplify

he/she/it would amplify

we would amplify

you would amplify

they would amplify

Conditional continuous

I would be amplifying

you would be amplifying

he/she/it would be amplifying

we would be amplifying

you would be amplifying

they would be amplifying

Conditional perfect

I would have amplify

you would have amplify

he/she/it would have amplify

we would have amplify

you would have amplify

they would have amplify

Conditional perfect continuous

I would have been amplifying

you would have been amplifying

he/she/it would have been amplifying

we would have been amplifying

you would have been amplifying

they would have been amplifying

IMPERATIVE

Imperative

you amplify
we let´s amplify
you amplify

NONFINITE VERB FORMS

Infinitive

to amplify

Past participle

amplified

Present Participle

amplifying

SYNONYME VON «AMPLIFY» AUF ENGLISCH

Die folgenden Wörter im Wörterbuch Englisch haben eine ähnliche oder gleiche Bedeutung wie «amplify» und gehören zu derselben grammatikalischen Kategorie.

Synonyme auf Englisch von amplify

augment · boost · deepen · develop · dilate · elaborate · enlarge · expand · expatiate · explain · extend · flesh out · go into detail · heighten · increase · intensify · lengthen · magnify · raise · round out · strengthen · stretch · supplement · widen

ÜBERSETZUNG VON AMPLIFY

Erfahre, wie die Übersetzung von amplify auf 25 Sprachen mit unserem mehrsprachigen Übersetzer Englisch lautet.

Die Übersetzungen von amplify auf andere Sprachen, die in diesem Bereich vorgestellt werden, sind zustande gekommen durch automatische statistische Übersetzung, wobei die Basiseinheit der Übersetzung das Wort «amplify» in Englisch ist.

• Übersetzer Deutsch - Chinesisch: 扩大 >
• Übersetzer Deutsch - Spanisch: amplificar
• Englisch: amplify
• Übersetzer Deutsch - Hindi: बढ़ाना
• Übersetzer Deutsch - Arabisch: تضخيم
• Übersetzer Deutsch - Russisch: усиливать
• Übersetzer Deutsch - Portugiesisch: amplificar
• Übersetzer Deutsch - Bengalisch: প্রশস্ত করা
• Übersetzer Deutsch - Französisch: amplifier
• Übersetzer Deutsch - Malaysisch: Memperkuatkan
• Übersetzer Deutsch - Deutsch: verstärken
• Übersetzer Deutsch - Japanisch: 増幅する
• Übersetzer Deutsch - Koreanisch: 증폭하다
• Übersetzer Deutsch - Javanisch: Amplify
• Übersetzer Deutsch - Vietnamesisch: khoa trương
• Übersetzer Deutsch - Tamil: பெருக்க
• Übersetzer Deutsch - Marathi: शक्ती वाढवणे
• Übersetzer Deutsch - Türkisch: yükseltmek
• Übersetzer Deutsch - Italienisch: amplificare
• Übersetzer Deutsch - Polnisch: wzmacniać
• Übersetzer Deutsch - Ukrainisch: посилювати
• Übersetzer Deutsch - Rumänisch: amplifica
• Übersetzer Deutsch - Griechisch: ενισχύουν
• Übersetzer Deutsch - Afrikaans: versterk
• Übersetzer Deutsch - Schwedisch: amplifiera
• Übersetzer Deutsch - Norwegisch: forsterke

10 ZITATE AUF ENGLISCH MIT «AMPLIFY»

Zitate und Redensarten mit dem Wort amplify.

1

Douglas Alexander

In an era of billion-person countries and trillion-pound economies, we need to find ways to amplify our voice. We are most likely to be heard when the Chinese negotiate with a £10 trillion E.U., not a £1.5 trillion Britain.

2

Ken Burns

In most films music is brought in at the end, after the picture is more or less locked, to amplify the emotions the filmmaker wants you to feel.

3

Chuck Close

A face is a road map of someone's life. Without any need to amplify that or draw attention to it, there's a great deal that's communicated about who this person is and what their life experiences have been.

4

Andre Gide

Most quarrels amplify a misunderstanding.

5

Ed Helms

It's incredibly fun to play someone that you don't like. It exorcises your own demons in a way. It's cathartic. We all have things that we don't like about ourselves, little things. And I get to amplify those things and put them out there. It's fun and it has a cleansing effect.

6

Rian Johnson

My favorite sci-fi always uses its hook to amplify some bigger theme or idea - some emotional thrust.

7

Patrick J. Kennedy

On the other hand, the American public possesses a great resilience and strength, and good risk communication strategies can tap into and even amplify those assets.

8

Steve Sabol

Look at a football field. It looks like a big movie screen. This is theatre. Football combines the strategy of chess. It's part ballet. It's part battleground, part playground. We clarify, amplify and glorify the game with our footage, the narration and that music, and in the end create an inspirational piece of footage.

9

Stefan Sagmeister

By far, the most determining factor of any brand is the product or the service the company produces. Branding companies have very rarely any significant influence on that, but it is, of course, in their interest to amplify their importance.

10

Will Smith

Money and success don't change people; they merely amplify what is already there.

10 BÜCHER, DIE MIT «AMPLIFY» IM ZUSAMMENHANG STEHEN

Entdecke den Gebrauch von amplify in der folgenden bibliographischen Auswahl. Bücher, die mit amplify im Zusammenhang stehen und kurze Auszüge derselben, um seinen Gebrauch in der Literatur kontextbezogen darzustellen.

WomanCode: Perfect Your Cycle, Amplify Your Fertility, ...

Simply put, once you support the flow of your hormones, you create flow in your life. In WomanCode, you will learn how to connect the dots between your symptoms, your biochemistry, and food.

Alisa Vitti, 2013

Amplify and Forward Relay Performance in WiMAX 802.16j

WiMAX has been proven to be a better alternative to the DSL and cable broadband services and also supports point to multipoint and mesh networks.

Jimish A. Thakkar, 2009

Amplify-and-forward Relaying in Wireless Communication Networks

Also, a closed form solution is provided for a single antenna AF relay network by minimizing MMSE subject to a global power constraint at the output of relays where each node in the network is equipped with one antenna.

Alireza Shahan Behbahani, 2009

credit chains and sectoral comovement: does the use of trade ...

WPS4525 Policy ReseaRch WoRking PaPeR 4525 Credit Chains and Sectoral Comovement: Does the Use of Trade Credit Amplify Sectoral Shocks? Claudio Raddatz The World Bank Development Research Group Macroeconomics and ...

Claudio Raddatz, 2008

Nik Software Captured: The Complete Guide to Using Nik ...

The control points in the Selective Adjustments section provide nearly the same controls as in the Global Adjustments section. On each control point, you find Brightness (Br), Contrast (Co), Structure (St), Amplify Whites (AW), Amplify Blacks  ...

Tony L. Corbell, Joshua A. Haftel, 2011

Generation and Characterization of an Attenuated Mutant in a ...

... Forms adaptor with P327 to introduce Not I site into pPV1 CTAGAATGCGGCCGCATG Left-F Amplify 5' flanking region upstream of FTL0552, contains Not I site GCGCGGCCGCGACTCATTCAGTATCTGGGA Left- R Amplify 5' flanking region ...

Wendy L. Sammons, 2007

Adobe Premiere Pro 2.0 Studio Techniques

feature, you can increase and amplify the audio and waveform with a few quick steps. 1. Open the project file Edit_in_Audition.prproj from the 2. APPST2 Lesson Files/Chapter 12 folder. In the Amplify sequence, find the audio/video clip (B Cam  ...

Jacob Rosenberg, 2006

Advances in Computer Science and Information Engineering: ...

2.2 Least Squares Estimation of Shrink-Amplify Center Shrink-amplify center is a very important parameter for matching and depth estimation. Firstly, it can optimize matching and eliminate mismatch; secondly, it is reference point for ...

David Jin, Sally Lin, 2012

Biotechnology for Fuels and Chemicals: The Twenty-Eighth ...

Oligo name Description Sequence ocfl 113 Amplify GND2 promoter region for UDG method ocfl 114 Amplify RPE1 open reading frame (ORF) downstream with 23-mer linker to GND2 promoter upstream for UDG method ocfl 115 Amplify GND2 ...

Jonathan R. Mielenz, K. Thomas Klasson, William S. Adney, 2009

Analyses and Designs in Amplify-and-forward Half-duplex ...

In this thesis, amplify-and-forward (AF) half-duplex relay systems are studied in the following three aspects: ergodic channel capacity, pairwise error probability and optimal precoder designs.

Yanwu Ding, 2007

10 NACHRICHTEN, IN DENEN DER BEGRIFF «AMPLIFY» VORKOMMT

Erfahre, worüber man in den einheimischen und internationalen Medien spricht und wie der Begriff amplify im Kontext der folgenden Nachrichten gebraucht wird.

Tools I Use To Amplify Social Campaigns

I am surprised how much of a one-man band I have become through social media thanks to a little help from my friends. Here are the top social ... «Business 2 Community, Jul 15»

Brucellosis speakers amplify difference between wildlife, livestock …

The disease brucellosis and its prevalence in bison and other wildlife in the Greater Yellowstone Area were the topic of a national scientific ... «Helena Independent Record, Jul 15»

Ultrasound fingerprint scanners amplify security

Ultrasound fingerprint scanners amplify security. Acoustic waves offer 3D print mapping for phones and computers. Boer Deng. 02 July 2015 ... «Nature.com, Jul 15»

Attackers abuse legacy routing protocol to amplify distributed denial …

Servers could be haunted by a ghost from the 1980s, as hackers have started abusing an obsolete routing protocol to launch distributed ... «Networks Asia, Jul 15»

The Boost You Need: Linksys AC1200 Amplify Wi-Fi Range Extender

In reviewing the new Linksys AC1200 Amplify Wi-Fi Range Extender, I was anxious to see if the sheer distance between our wireless antenna ... «GeekDad, Jul 15»

Amplify Snacks, Maker of SkinnyPop, Files For IPO

Austin's latest IPO filing comes this week, not from the technology sector, but from the snack foods area. Austin-based Amplify Snack Brands ... «Texas Tech Pulse, Jun 15»

Amplify likely to end tablets for schools program

Bloomberg reports that Amplify, media company News Corp.'s high profile foray into education, is winding down its tablet program and has ... «Education Dive, Jun 15»

Twitter Does First Season-Long Amplify Ad Deal for 'Pretty Little …

That's because Johnson & Johnson has signed up for a seasonlong ad deal with ABC Family via Twitter's Amplify program, which targets TV ... «Variety, Jun 15»

Amplify Snack's PE Backers Line Up $200M IPO

Law360, New York (June 29, 2015, 3:48 PM ET) -- Private equity-backed Amplify Snack Brands Inc., the Texas-based maker of SkinnyPop popcorn, filed papers ... «Law360, Jun 15»

Sachin Pilot to lead Congress roadshow to amplify Vasundhara …

NEW DELHI: The Congress plans to seek public support to put pressure on the Narendra Modi government to dismiss Vasundhara Raje as ... «Bayoubuzz, Jun 15»