Significado de "pelf" en el diccionario de inglés

ETIMOLOGÍA DE LA PALABRA PELF

From Old French pelfre booty; related to Latin pilāre to despoil.

Se denomina etimología al estudio del origen de la palabras y sus cambios estructurales y de significado.

PRONUNCIACIÓN DE PELF EN INGLÉS

pelf  [pɛlf]

CATEGORIA GRAMATICAL DE PELF

Pelf es un sustantivo.

El nombre o sustantivo es aquel tipo de palabras cuyo significado determina la realidad. Los sustantivos nombran todas las cosas: personas, objetos, sensaciones, sentimientos, etc.

QUÉ SIGNIFICA PELF EN INGLÉS

Dinero

Money

El dinero es cualquier objeto o registro verificable que generalmente se acepta como pago por bienes y servicios y el reembolso de deudas en un país o contexto socioeconómico determinado. Las principales funciones del dinero se distinguen como: un medio de intercambio; Una unidad de cuenta; Una reserva de valor; Y, ocasionalmente en el pasado, un estándar de pago diferido. Cualquier tipo de objeto o registro verificable que cumpla con estas funciones puede considerarse dinero. El dinero es históricamente un fenómeno de mercado emergente que establece un dinero de mercancías, pero casi todos los sistemas monetarios contemporáneos se basan en dinero fiat. El dinero Fiat, como cualquier cheque o nota de deuda, no tiene valor de uso intrínseco como un bien físico. Deriva su valor al ser declarado por un gobierno como moneda de curso legal; Es decir, debe ser aceptada como una forma de pago dentro de los límites del país, para "todas las deudas, públicas y privadas". Tales leyes en la práctica hacen que el dinero fiduciario adquiera el valor de cualquiera de los bienes y servicios que se pueden negociar dentro de la nación que lo emite. La fuente de dinero de un país consiste en la moneda y generalmente incluye el dinero del banco.

Money is any object or verifiable record that is generally accepted as payment for goods and services and repayment of debts in a particular country or socio-economic context. The main functions of money are distinguished as: a medium of exchange; a unit of account; a store of value; and, occasionally in the past, a standard of deferred payment. Any kind of object or verifiable record that fulfills these functions can be considered money. Money is historically an emergent market phenomenon establishing a commodity money, but nearly all contemporary money systems are based on fiat money. Fiat money, like any check or note of debt, is without intrinsic use value as a physical commodity. It derives its value by being declared by a government to be legal tender; that is, it must be accepted as a form of payment within the boundaries of the country, for "all debts, public and private". Such laws in practice cause fiat money to acquire the value of any of the goods and services that it may be traded for within the nation that issues it. The money supply of a country consists of currency and usually includes bank money.

definición de pelf en el diccionario inglés

La definición de pelf en el diccionario es dinero o riqueza, especialmente si se adquiere deshonestamente; lucro.

TRADUCCIÓN DE PELF

Conoce la traducción de pelf a 25 idiomas con nuestro traductor multilingüe.

Las traducciones de pelf presentadas en esta sección han sido obtenidas mediante traducción automática estadística a partir del idioma inglés.

• Traductor inglés - chino: PELF
• Traductor inglés - español: pelf
• inglés: pelf
• Traductor inglés - hindi: स्र्पये
• Traductor inglés - árabe: pelf
• Traductor inglés - ruso: PELF
• Traductor inglés - portugués: pelf
• Traductor inglés - bengalí: টাকাকড়ি
• Traductor inglés - francés: lucre
• Traductor inglés - malayo: Pelf
• Traductor inglés - alemán: Moneten
• Traductor inglés - japonés: あぶく銭
• Traductor inglés - coreano: pelf
• Traductor inglés - javanés: Pelem
• Traductor inglés - vietnamita: tiền bạc
• Traductor inglés - tamil: pelf
• Traductor inglés - maratí: पीएलएच
• Traductor inglés - turco: vurgun
• Traductor inglés - italiano: pelf
• Traductor inglés - polaco: Pelf
• Traductor inglés - ucraniano: PELF
• Traductor inglés - rumano: parale
• Traductor inglés - griego: παράδες
• Traductor inglés - afrikáans: duiten
• Traductor inglés - sueco: pelf
• Traductor inglés - noruego: pelf

10 LIBROS DEL INGLÉS RELACIONADOS CON «PELF»

Descubre el uso de pelf en la siguiente selección bibliográfica. Libros relacionados con pelf y pequeños extractos de los mismos para contextualizar su uso en la literatura.

Pelf - Emily's Men of Greed:

If you're reading this book and did not purchase it, or it was not purchased for your use only, then please return to Google Play and purchase your own copy. Thank you for respecting the hard work of this author. Contents Pelf About the Author ...

Derek Haines, 2014

The Collected Stories of J.A. Cummings

‚Oh, yes,‛ Pelf said. ‚I do believe in you.‛ ‚And do you believe in yourself, Pelf? If you do not, then you can never learn the secrets that I have to tell.‛ Pelf swallowed hard and searched his feelings. ‚Yes,‛ he nodded, knowing it was true.

J.A. Cummings

Walls

Jinks was impressed, and after the intense psychological screening that every potential SWAT officer receives, Pelf was placed in training. Three months later, thirty days of climbing barricades, hurdling through the obstacle course, being ...

D. C. Wilson, Nancy Rabuck Wilson, 2001

Field Guide to Freshwater Fishes of California

DESCRIPTION: Long AF ( 16 to 19 rays); prickles on skin behind PecF or over entire body; DF usually joined to one-third height of first soft ray; 1st DF = 8 to 10, 2d DF = 19 to23,PelF = 4, AF = 17 to 19; ad. SL 6 to 9 cm (2.4 to 3.5 in.), max.

Samuel M. McGinnis, 2006

Antimicrobial Therapy in Veterinary Medicine

Steeve Giguère, John F. Prescott, Patricia M. Dowling. (A) 10 + Plasma —I— PELF 1 + BAL cells DCA concentration (pg/mL) O :0 O 0.001 . I I I I I I I I I I 0 24 48 72 96 120 144 168 192 216 240 Time (h) ...

Steeve Giguère, John F. Prescott, Patricia M. Dowling, 2013

Class Politics in the Information Age

Professional Pelf While the surplus wage threshold is basic to determining the respective shares of labor and professionals in surplus wages, the average paycheck defines the lower limit of professionals' pelf comparable to capital income or ...

Donald Clark Hodges, 2000

Multidimensional NMR Methods for the Solution State

(Top) Simulation of the outcome of a DISTINCT scheme (a) with respect to a classical powder pattern (b) for a heteronuclear dipolar coupling. (Bottom) Example of the DISTINCT PELF spectrum on the headgroup and glycerol regions of lecithin ...

Gareth A. Morris, James W. Emsley, 2012

Men and Manners: A Novel

ed with the requisites tor the meal, Mrs. Pelf ordered her to call in her master. Presently Pelf returned.- " That young sellow," he said, "that- came in for debt this morning, is half distracted yonder for want of company, and praying like bewitched ...

Francis Lathom, 1800

Legionella: from protozoa to humans

Primer name Nucleotide sequence pelA cya F pelA cya R CTGCAGCTACATGAGCACACAAACAG pelB cya F pelB cya R pelD cya F pelD cya R pelE cya F pelE cya R pelF cya F GGATCCTTATGCGTAGCAGAACAGAA pelF cya R pelH cya F ...

Carmen Buchrieser

The English dialect dictionary, being the complete ...

The April hoeing, when many thistles would be, as a matter of course, cut up with the other 'pelf' (H.K.). Glo.l Car. And I raked all the pilf off the land, THOMAS Rairdiga! Rhymes (1895) 6; Cor.1 Light grass and roots raked together to be burnt; ...

Joseph Wright

10 NOTICIAS EN LAS QUE SE INCLUYE EL TÉRMINO «PELF»

Conoce de qué se habla en los medios de comunicación nacionales e internacionales y cómo se emplea el término pelf en el contexto de las siguientes noticias.

How Serious Are The Twins About 2015?

Pelf could have some value to a sub-.500 club that simply needs a guy to eat innings while treading water, but for a team like the Twins that is in ... «Twins Daily, Jul 15»

Doling Out Thoughts

Just a cursory look at the pelf and privileges enjoyed by unelected, and far less accountable, senior government employees, makes that clear. «Outlook, Jul 15»

Letter: GOP's future

Fat cat donors directly or indirectly derive their pelf from the availability of cheap labor from people who can survive while working for less than ... «New Bern Sun Journal, Jul 15»

Time for BCCI to put its house in order

... has become a motley body of vested interests willing to fight or sleep with each other for power and pelf, not necessarily to the game's benefit ... «Hindustan Times, Jul 15»

Surjya, Biman slam Mamata on corruption

... of wealth and pelf of the Trinamool leaders on each passing day, the Opposition leader and CPI(M) state secretary Surjya Kanta Mishra came ... «The Echo of India, Jul 15»

A Ramadan story

... that their sacrifice and compassion for “their brother” will serve as a template for those who, in their insatiable greed for power, pomp and pelf, ... «Trinidad News, Jul 15»

Learning to live with political dynasties

Dynasty: We just have to learn to live with it even if our dynasty-creating, power-kapit-tuko politicians insist on passing on positions and pelf to ... «Inquirer.net, Jul 15»

Man who could do no wrong: N Srinivasan's charmed reign over …

There was unprecedented power and pelf at Srinivasan's disposal. Before his tenure, a BCCI president had one term of three years. In 2012, a ... «Economic Times, Jul 15»

Love Is Blind, and So Are the Courtney Love Haters

Sorry, Courtney Love is not a blond ingenue who conned her way to fame and pelf. No, she hustled (literally, at a Times Square peep show in ... «Newsweek, Jul 15»

Modi's honeymoon is over

The BJP, despite its RSS stream, is as steeped in the culture of manipulative politics as any other party and as tempted by the power and pelf of ... «Chandigarh Tribune, Jul 15»